Human ORFeome, Internal ID: 8
BC number:  BC003353 UCSCEntrez Gene ID:  84246
Length: 408Symbol:  MED10
Resource Plate: GDEh81113Resource Plate Position:  G11
Lentiviral Plate: CCSBBroad304_178D1Lentiviral Position:  B09
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGCGGAGAAGTTTGAC
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGTAAGAAGGCGGGTGATCCT
Description:  mediator complex subunit 10 CHROMOSOME: 5
Template Information: 
Vendor Plate:  1Vendor Position:  A08
Collection:  Vendor Name: Open Biosystems
Vector: pCMV-SPORT6Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_10 placenta cell line
Clone ID:  2899986 Genbank Accession: KJ894951
GI:  13097161
MGC Coding Sequence: 
atggcggagaagtttgaccacctagaggagcacctggagaagttcgtggagaacattcggcagctcggcatcatcgtcagtgacttccagcccagcagcc
aggccgggctcaaccaaaagctgaattttattgttactggcttacaggatattgacaagtgcagacagcagcttcatgatattactgtaccgttagaagt
ttttgaatatatagatcaaggtcgaaatccccagctctacaccaaagagtgcctggagagggctctagctaaaaatgagcaagttaaaggcaagatcgac
accatgaagaaatttaaaagcctgttgattcaagaactttctaaagtatttccggaagacatggctaagtatcgaagcatccggggggaggatcacccgc
cttcttaa
cDNA Sequence (including UTRs): 
cgctgctggttgaggctgtgtgggtgggggacgggccgaggcgatggcggagaagtttgaccacctagaggagcacctggagaagttcgtggagaacatt
cggcagctcggcatcatcgtcagtgacttccagcccagcagccaggccgggctcaaccaaaagctgaattttattgttactggcttacaggatattgaca
agtgcagacagcagcttcatgatattactgtaccgttagaagtttttgaatatatagatcaaggtcgaaatccccagctctacaccaaagagtgcctgga
gagggctctagctaaaaatgagcaagttaaaggcaagatcgacaccatgaagaaatttaaaagcctgttgattcaagaactttctaaagtatttccggaa
gacatggctaagtatcgaagcatccggggggaggatcacccgccttcttaaccagctcaccctccctgtgtgaagatcccctgggactgcgatgcggcgt
gaggctgggactgcgagtgctgacgccaccttcctgctgaggtgggactgggccctggacacacccctcagcccctctgtcctcattgtttggcctcatg
ggaccgaggggctggaggagaggcggagctgtgccccagctgttccagcagcttgtctggcgtcaactggctttcagagtgctgacccctcatcactgtg
gggatcattctctctgagggcagatgaggcgcaggaaaatagtcttggaaatgttaaatatgatgggtaaattaaaagttttacaacattcaaaaaaaaa
aaaaa