Human ORFeome, Internal ID: 741
BC number:  BC015514 UCSCEntrez Gene ID:  7035
Length: 756Symbol:  TFPI
Resource Plate: GDEh81041Resource Plate Position:  E05
Lentiviral Plate: CCSBBroad304_046D1Lentiviral Position:  E11
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGATTTACACAATGAAGAAAGTACATGCAC
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGTAACATAGGCATGAAATGCTATCCAA
Description:  tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) CHROMOSOME: 2
Template Information: 
Vendor Plate:  18Vendor Position:  B12
Collection:  Vendor Name: Open Biosystems
Vector: pCMV-SPORT6Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_70 pancreatic tumor cell line
Clone ID:  3902987 Genbank Accession: KJ897659
GI:  15930155
MGC Coding Sequence: 
atgatttacacaatgaagaaagtacatgcactttgggcttctgtatgcctgctgcttaatcttgcccctgcccctcttaatgctgattctgaggaagatg
aagaacacacaattatcacagatacggagttgccaccactgaaacttatgcattcattttgtgcattcaaggcggatgatggcccatgtaaagcaatcat
gaaaagatttttcttcaatattttcactcgacagtgcgaagaatttatatatgggggatgtgaaggaaatcagaatcgatttgaaagtctggaagagtgc
aaaaaaatgtgtacaagagataatgcaaacaggattataaagacaacattgcaacaagaaaagccagatttctgctttttggaagaagatcctggaatat
gtcgaggttatattaccaggtatttttataacaatcagacaaaacagtgtgaacgtttcaagtatggtggatgcctgggcaatatgaacaattttgagac
actggaagaatgcaagaacatttgtgaagatggtccgaatggtttccaggtggataattatggaacccagctcaatgctgtgaataactccctgactccg
caatcaaccaaggttcccagcctttttgttacaaaagaaggaacaaatgatggttggaagaatgcggctcatatttaccaagtctttctgaacgccttct
gcattcatgcatccatgttctttctaggattggatagcatttcatgcctatgttaa
cDNA Sequence (including UTRs): 
aacagacagcagcgactttaggctggataatagtcaaattcttacctcgctctttcactgctagtaagatcagattgcgttctttcagttactcttcaat
cgccagtttcttgatctgcttctaaaagaagaagtagagaagataaatcctgtcttcaatacctggaaggaaaaacaaaataacctcaactccgttttga
aaaaaacattccaagaactttcatcagagattttacttagatgatttacacaatgaagaaagtacatgcactttgggcttctgtatgcctgctgcttaat
cttgcccctgcccctcttaatgctgattctgaggaagatgaagaacacacaattatcacagatacggagttgccaccactgaaacttatgcattcatttt
gtgcattcaaggcggatgatggcccatgtaaagcaatcatgaaaagatttttcttcaatattttcactcgacagtgcgaagaatttatatatgggggatg
tgaaggaaatcagaatcgatttgaaagtctggaagagtgcaaaaaaatgtgtacaagagataatgcaaacaggattataaagacaacattgcaacaagaa
aagccagatttctgctttttggaagaagatcctggaatatgtcgaggttatattaccaggtatttttataacaatcagacaaaacagtgtgaacgtttca
agtatggtggatgcctgggcaatatgaacaattttgagacactggaagaatgcaagaacatttgtgaagatggtccgaatggtttccaggtggataatta
tggaacccagctcaatgctgtgaataactccctgactccgcaatcaaccaaggttcccagcctttttgttacaaaagaaggaacaaatgatggttggaag
aatgcggctcatatttaccaagtctttctgaacgccttctgcattcatgcatccatgttctttctaggattggatagcatttcatgcctatgttaatatt
tgtgcttttggcatttccttaatatttatatgtatacgtgatgcctttgatagcatactgctaataaagttttaatatttacatgcaaaaaaaaaaaaaa
aaaaaaaa