Human ORFeome, Internal ID: 718
BC number:  BC015519 UCSCEntrez Gene ID:  9141
Length: 378Symbol:  PDCD5
Resource Plate: GDEh81009Resource Plate Position:  D06
Lentiviral Plate: CCSBBroad304_089D1Lentiviral Position:  F10
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGCGGACGAGGAGCTT
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCAATAATCGTCATCTTCATCAGAGT
Description:  programmed cell death 5 CHROMOSOME: 19
Template Information: 
Vendor Plate:  17Vendor Position:  H05
Collection:  Vendor Name: Open Biosystems
Vector: pCMV-SPORT6Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_69 lung tumor cell line
Clone ID:  3888459 Genbank Accession: KJ892696
GI:  34782849
MGC Coding Sequence: 
atggcggacgaggagcttgaggcgctgaggagacagaggctggccgagctgcaggccaaacacggggatcctggtgatgcggcccaacaggaagcaaagc
acagggaagcagaaatgagaaacagtatcttagcccaagttctggatcagtcggcccgggccaggttaagtaacttagcacttgtaaagcctgaaaaaac
taaagcagtagagaattaccttatacagatggcaagatatggacaactaagtgagaaggtatcagaacaaggtttaatagaaatccttaaaaaagtaagc
caacaaacagaaaagacaacaacagtgaaattcaacagaagaaaagtaatggactctgatgaagatgacgattattga
cDNA Sequence (including UTRs): 
gcgagagtgaccgcggctgctccagcgctgacgccgagccatggcggacgaggagcttgaggcgctgaggagacagaggctggccgagctgcaggccaaa
cacggggatcctggtgatgcggcccaacaggaagcaaagcacagggaagcagaaatgagaaacagtatcttagcccaagttctggatcagtcggcccggg
ccaggttaagtaacttagcacttgtaaagcctgaaaaaactaaagcagtagagaattaccttatacagatggcaagatatggacaactaagtgagaaggt
atcagaacaaggtttaatagaaatccttaaaaaagtaagccaacaaacagaaaagacaacaacagtgaaattcaacagaagaaaagtaatggactctgat
gaagatgacgattattgaactacaagtgctcacagactagaacttaacggaacaagtctaggacagaagttaagatctgattatttactttgtttattgt
ctatatgccttttaaaaaaataaacttgttatgcaaaataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa