Human ORFeome, Internal ID: 704
BC number:  BC015537 UCSCEntrez Gene ID:  3046
Length: 444Symbol:  HBE1
Resource Plate: GDEh81022Resource Plate Position:  F11
Lentiviral Plate: CCSBBroad304_090D1Lentiviral Position:  C10
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGTGCATTTTACTGCTGAGGA
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCAGTGGTACTTATGGGCCAGG
Description:  hemoglobin, epsilon 1 CHROMOSOME: 11
Template Information: 
Vendor Plate:  17Vendor Position:  G02
Collection:  Vendor Name: Open Biosystems
Vector: pCMV-SPORT6Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_68 lung tumor cell line
Clone ID:  3884290 Genbank Accession: KJ891334
GI:  34190424
MGC Coding Sequence: 
atggtgcattttactgctgaggagaaggctgccgtcactagcctgtggagcaagatgaatgtggaagaggctggaggtgaagccttgggcagactcctcg
ttgtttacccctggacccagagattttttgacagctttggaaacctgtcgtctccctctgccatcctgggcaaccccaaggtcaaggcccatggcaagaa
ggtgctgacttcctttggagatgctattaaaaacatggacaacctcaagcccgcctttgctaagctgagtgagctgcactgtgacaagctgcatgtggat
cctgagaacttcaagctcctgggtaacgtgatggtgattattctggctactcactttggcaaggagttcacccctgaagtgcaggctgcctggcagaagc
tggtgtctgctgtcgccattgccctggcccataagtaccactga
cDNA Sequence (including UTRs): 
gccatggttgtgaggcctccccagctatgtggaactagacttcaagaagttaagcaacttgctcaagatcatctaagaaatagatgaggagccaacaaaa
aagagcctcaggatccagcacacattatcacaaacttagtgtccatccatcactgctgaccctctccggacctgactccacccctgagggacacaggtca
gccttgaccaatgacttttaagtaccatggagaacagggggccagaacttcggcagtaaagaataaaaggccagacagagaggcagcagcacatatctgc
ttccgacacagctgcaatcactagcaagctctcaggcctggcatcatggtgcattttactgctgaggagaaggctgccgtcactagcctgtggagcaaga
tgaatgtggaagaggctggaggtgaagccttgggcagactcctcgttgtttacccctggacccagagattttttgacagctttggaaacctgtcgtctcc
ctctgccatcctgggcaaccccaaggtcaaggcccatggcaagaaggtgctgacttcctttggagatgctattaaaaacatggacaacctcaagcccgcc
tttgctaagctgagtgagctgcactgtgacaagctgcatgtggatcctgagaacttcaagctcctgggtaacgtgatggtgattattctggctactcact
ttggcaaggagttcacccctgaagtgcaggctgcctggcagaagctggtgtctgctgtcgccattgccctggcccataagtaccactgagttctcttcca
gtttgcaggtgttcctgtgaccctgacaccctccttctgcacatggggactgggcttggccttgagagaaagccttctgtttaataaagtacattttctt
cagtaaaaaaaaaaaaaaa