Human ORFeome, Internal ID: 6588
BC number:  BC009477 UCSCEntrez Gene ID:  11034
Length: 498Symbol:  DSTN
Resource Plate: GDEh81024Resource Plate Position:  F07
Lentiviral Plate: CCSBBroad304_092D1Lentiviral Position:  E06
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGCCTCAGGAGTGCAA
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGTACACAGGGCATCCTTCA
Description:  destrin (actin depolymerizing factor) CHROMOSOME: 20
Template Information: 
Vendor Plate:  57Vendor Position:  E01
Collection:  Vendor Name: Open Biosystems
Vector: pOTB7Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_7 lung tumor cell line
Clone ID:  3938287 Genbank Accession: KJ893208
GI:  33874740
MGC Coding Sequence: 
atggcctcaggagtgcaagtagctgatgaagtatgtcgcattttttatgacatgaaagttcgtaaatgctccacaccagaagaaatcaagaaaagaaaga
aggctgtcattttttgtctcagtgcagacaaaaagtgcatcattgtagaagaaggcaaagagatcttggttggagatgttggtgtaaccataactgatcc
tttcaagcattttgtgggaatgcttcctgaaaaagattgtcgctatgctttgtatgatgcaagctttgaaacaaaagaatccagaaaagaagagttgatg
ttttttttgtgggcaccagaactagcacctctgaaaagtaaaatgatctatgcaagctccaaggatgcaattaaaaagaaatttcaaggcataaaacatg
aatgtcaagcaaatggaccagaagatctcaatcgggcttgtattgctgaaaagttaggtggatccttaattgtagcctttgaaggatgccctgtgtag
cDNA Sequence (including UTRs): 
gcgttccgtcctgaggcgcgcccgccccggggtaagctcgcgccgccgcgtcagctcagcgctgggtctctcggtcccgcagccgtgaggaggacggtct
gcatactcgctgcccgccggctccctcccccgcgtccctgcgaccgccgcggcgaagatggcctcaggagtgcaagtagctgatgaagtatgtcgcattt
tttatgacatgaaagttcgtaaatgctccacaccagaagaaatcaagaaaagaaagaaggctgtcattttttgtctcagtgcagacaaaaagtgcatcat
tgtagaagaaggcaaagagatcttggttggagatgttggtgtaaccataactgatcctttcaagcattttgtgggaatgcttcctgaaaaagattgtcgc
tatgctttgtatgatgcaagctttgaaacaaaagaatccagaaaagaagagttgatgttttttttgtgggcaccagaactagcacctctgaaaagtaaaa
tgatctatgcaagctccaaggatgcaattaaaaagaaatttcaaggcataaaacatgaatgtcaagcaaatggaccagaagatctcaatcgggcttgtat
tgctgaaaagttaggtggatccttaattgtagcctttgaaggatgccctgtgtagattattcagtgccacaaattgaaagcttccatgtttaatgttatc
ctcttgctatataaataaagcaaatatatttaggccagggtctcactgagggggagctgtcttgtcatcttttagagtaaactattctataaacatatgc
aaacagccctaaataaatctaaagtctaaagttttaaaaaaaaaaaaaaaaaaaaaaaa