Human ORFeome, Internal ID: 6474
BC number:  BC013977 UCSCBC025374 UCSCEntrez Gene ID:  55658
Length: 936Symbol:  RNF126
Resource Plate: GDEh81060Resource Plate Position:  E02
Lentiviral Plate: CCSBBroad304_003D1Lentiviral Position:  C08
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGCCGAGGCGTCGCCGCA
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCACGAGTTGCTTGTGGCGTT
Description:  ring finger protein 126 CHROMOSOME: 19
Template Information: 
Vendor Plate:  83Vendor Position:  B08
Collection:  Vendor Name: Open Biosystems
Vector: pDNR-LIBCatalog Number: 
Information Source: GENEBANK WEBSITE Library: NIH_MGC_57
Clone ID:  4093350 Genbank Accession: KJ899167
GI:  33991247, 19263500
MGC Coding Sequence: 
atggccgaggcgtcgccgcatcccggacggtacttctgccactgctgctccgtggagatcgtcccgcgcctgccggattatatctgtccaagatgcgagt
ctggttttatcgaggagcttccggaagagaccaggagcacagaaaatggttctgccccctccacagctcccacagaccagagccggccaccgctggagca
cgtggaccagcacctgttcacgctgccgcagggctacggacagtttgctttcggcatcttcgatgacagcttcgagatccccacgttccctcctggggcg
caggctgacgacggcagggaccctgagagccggcgggagagagaccatccgtcccggcaccggtacggcgcccgacagccccgcgcccgcctcaccacgc
ggcgggccaccggccggcacgaaggcgtccccacgctggaagggatcatccagcagctcgtcaacggcatcatcacgcccgccaccatccccagcctggg
cccctggggagtcctgcactcaaaccctatggactacgcctggggggccaacggcctggatgccatcatcacacagctcctcaatcagtttgaaaacaca
ggccccccaccggcagataaagagaaaatccaggccctccccaccgtccccgtcactgaggagcacgtaggctccgggctcgagtgccctgtgtgcaagg
acgactacgcgctgggtgagcgtgtgcggcagctgccctgcaaccacctgttccacgacggctgcatcgtgccctggctggagcagcacgacagctgccc
cgtctgccgaaaaagcctcacgggacagaacacggccacgaacccccctggcctcactggggtgagcttctcctcctcgtcgtcatcgtcctcctccagc
tcgcccagcaacgagaacgccacaagcaactcgtga
cDNA Sequence (including UTRs): 
ggggggggggcgggcggcgcggagtaggtggcggcggccatggccgaggcgtcgccgcatcccggacggtacttctgccactgctgctccgtggagatcg
tcccgcgcctgccggattatatctgtccaagatgcgagtctggttttatcgaggagcttccggaagagaccaggagcacagaaaatggttctgccccctc
cacagctcccacagaccagagccggccaccgctggagcacgtggaccagcacctgttcacgctgccgcagggctacggacagtttgctttcggcatcttc
gatgacagcttcgagatccccacgttccctcctggggcgcaggctgacgacggcagggaccctgagagccggcgggagagagaccatccgtcccggcacc
ggtacggcgcccgacagccccgcgcccgcctcaccacgcggcgggccaccggccggcacgaaggcgtccccacgctggaagggatcatccagcagctcgt
caacggcatcatcacgcccgccaccatccccagcctgggcccctggggagtcctgcactcaaaccctatggactacgcctggggggccaacggcctggat
gccatcatcacacagctcctcaatcagtttgaaaacacaggccccccaccggcagataaagagaaaatccaggccctccccaccgtccccgtcactgagg
agcacgtaggctccgggctcgagtgccctgtgtgcaaggacgactacgcgctgggtgagcgtgtgcggcagctgccctgcaaccacctgttccacgacgg
ctgcatcgtgccctggctggagcagcacgacagctgccccgtctgccgaaaaagcctcacgggacagaacacggccacgaacccccctggcctcactggg
gtgagcttctcctcctcgtcgtcatcgtcctcctccagctcgcccagcaacgagaacgccacaagcaactcgtgagcccacgtcggccgtcgggaaagca
cggggcctttcccacccaccctcagccagcgccacacggcacccacagactgggtgccccggcggcgccacgcttggctggtcagcgctgcaggtcccgc
ctgttccagggcaggacccgggcccggcccaccggccccctggcttgggaaggcgtgggccacatggtcccctctggggcgtccccagcctccccgtcct
ctgtctaacctcaccctctaaacgttcagcggtggaaagatttttataattttaaattattactgctttgaaataaacggacgtttgagcgcaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaa