Human ORFeome, Internal ID: 6421
BC number:  BC010367 UCSCEntrez Gene ID:  54969
Length: 1041Symbol:  C4orf27
Resource Plate: GDEh81065Resource Plate Position:  H03
Lentiviral Plate: CCSBBroad304_012D1Lentiviral Position:  F05
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGTCGGCGGTGGCGGGAA
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCATGCAGCAAGTTGGTCTATGT
Description:  chromosome 4 open reading frame 27 CHROMOSOME: 4
Template Information: 
Vendor Plate:  54Vendor Position:  D08
Collection:  Vendor Name: Open Biosystems
Vector: pDNR-LIBCatalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_62 melanoma cell line
Clone ID:  4334172 Genbank Accession: KJ899042
GI:  14714480
MGC Coding Sequence: 
atggtcggcggtggcgggaagcgcaggcccggcggggaggggccgcagtgtgaaaaaacaactgatgtgaagaaaagtaaattctgtgaagctgatgtct
ccagtgaccttcgaaaagaagtagaaaatcattataagctttctttacctgaagatttctatcacttctggaagttctgtgaagaacttgatcctgaaaa
gccatctgattcactttctgcaagccttggacttcaattagttggtccttatgatatccttgctggaaaacataaaacgaagaaaaaatcaacaggcctg
aattttaaccttcactggaggttttactatgatcctcctgagttccagaccattattattggagataataaaactcagtaccacatggggtatttcaggg
attctcctgatgaatttcctgtatatgttggtataaatgaagcaaagaaaaattgtataattgttccaaatggagataatgtatttgctgcagtcaaatt
atttttgacgaaaaaacttaaagaaataacggataaaaagaaaatcaatctcttgaaaaacatagatgaaaaactcacagaagcagccagagaattgggg
tactcgcttgaacagagaaccgtgaagatgaaacagagagataagaaagttgtgacaaagacctttcatggtgcaggcttggttgttccagtagataaaa
atgatgttgggtaccgagagctccctgaaacagatgctgacctcaagagaatttgcaagacaatagttgaggctgcaagtgatgaggagagactaaaagc
ttttgctcccattcaggaaatgatgacttttgtgcagtttgctaatgatgaatgtgattatggcatggggcttgaattgggaatggatctcttttgctat
ggctcacattattttcataaagttgctggccagcttttacctcttgcatataatctgttgaagaggaatctgtttgcagaaattattgaggagcatctgg
caaacagaagtcaagagaacatagaccaacttgctgcatga
cDNA Sequence (including UTRs): 
gggggaattctgctggcgctgcagctgcagaatggtcggcggtggcgggaagcgcaggcccggcggggaggggccgcagtgtgaaaaaacaactgatgtg
aagaaaagtaaattctgtgaagctgatgtctccagtgaccttcgaaaagaagtagaaaatcattataagctttctttacctgaagatttctatcacttct
ggaagttctgtgaagaacttgatcctgaaaagccatctgattcactttctgcaagccttggacttcaattagttggtccttatgatatccttgctggaaa
acataaaacgaagaaaaaatcaacaggcctgaattttaaccttcactggaggttttactatgatcctcctgagttccagaccattattattggagataat
aaaactcagtaccacatggggtatttcagggattctcctgatgaatttcctgtatatgttggtataaatgaagcaaagaaaaattgtataattgttccaa
atggagataatgtatttgctgcagtcaaattatttttgacgaaaaaacttaaagaaataacggataaaaagaaaatcaatctcttgaaaaacatagatga
aaaactcacagaagcagccagagaattggggtactcgcttgaacagagaaccgtgaagatgaaacagagagataagaaagttgtgacaaagacctttcat
ggtgcaggcttggttgttccagtagataaaaatgatgttgggtaccgagagctccctgaaacagatgctgacctcaagagaatttgcaagacaatagttg
aggctgcaagtgatgaggagagactaaaagcttttgctcccattcaggaaatgatgacttttgtgcagtttgctaatgatgaatgtgattatggcatggg
gcttgaattgggaatggatctcttttgctatggctcacattattttcataaagttgctggccagcttttacctcttgcatataatctgttgaagaggaat
ctgtttgcagaaattattgaggagcatctggcaaacagaagtcaagagaacatagaccaacttgctgcatgagtaaggtggctttgattggtgtacagta
tttcaaaggactagtattaaacttgtgatttttgttttgtttttaaggaatacaaaaaataaacatttactaaaaacgcaaaaaaaaaaaaaaaaaaaaa
aaaaaaaa