Human ORFeome, Internal ID: 6351
BC number:  BC010364 UCSCEntrez Gene ID:  55168
Length: 591Symbol:  MRPS18A
Resource Plate: GDEh81057Resource Plate Position:  F04
Lentiviral Plate: CCSBBroad304_031D1Lentiviral Position:  B03
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGCGGCCCTCAAGGCTC
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCAGTGATACAGCTTCCAAGGTGTT
Description:  mitochondrial ribosomal protein S18A CHROMOSOME: 6
Template Information: 
Vendor Plate:  53Vendor Position:  D04
Collection:  Vendor Name: Open Biosystems
Vector: pDNR-LIBCatalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_83 prostate
Clone ID:  4248325 Genbank Accession: KJ894147
GI:  14714475
MGC Coding Sequence: 
atggcggccctcaaggctctggtgtccggctgtgggcggcttctccgtgggctactagcgggcccggcagcgaccagctggtctcggcttccagctcgcg
ggttcagggaagtggtggagacccaagaagggaagacaactataattgaaggccgtatcacagcgactcccaaggagagtccaaatcctcctaacccctc
tggccagtgccccatctgccgttggaacctgaagcacaagtataactatgacgatgttctgctgcttagccagttcatccggcctcatggaggcatgctg
ccccgaaagatcacaggcctatgccaggaagaacaccgcaagatcgaggagtgtgtgaagatggcccaccgagcaggtctattaccaaatcacaggcctc
ggcttcctgaaggagttgttccgaagagcaaaccccaactcaaccggtacctgacgcgctgggctcctggctccgtcaagcccatctacaaaaaaggccc
ccgctggaacagggtgcgcatgcccgtggggtcaccccttctgagggacaatgtctgctactcaagaacaccttggaagctgtatcactga
cDNA Sequence (including UTRs): 
gggggaagatggcggccctcaaggctctggtgtccggctgtgggcggcttctccgtgggctactagcgggcccggcagcgaccagctggtctcggcttcc
agctcgcgggttcagggaagtggtggagacccaagaagggaagacaactataattgaaggccgtatcacagcgactcccaaggagagtccaaatcctcct
aacccctctggccagtgccccatctgccgttggaacctgaagcacaagtataactatgacgatgttctgctgcttagccagttcatccggcctcatggag
gcatgctgccccgaaagatcacaggcctatgccaggaagaacaccgcaagatcgaggagtgtgtgaagatggcccaccgagcaggtctattaccaaatca
caggcctcggcttcctgaaggagttgttccgaagagcaaaccccaactcaaccggtacctgacgcgctgggctcctggctccgtcaagcccatctacaaa
aaaggcccccgctggaacagggtgcgcatgcccgtggggtcaccccttctgagggacaatgtctgctactcaagaacaccttggaagctgtatcactgac
agagagcagtgcttccagagttcctcctgcacctgtgctggggagtaggaggcccactcacaagcccttggccacaactatactcctgtcccaccccacc
acgatggcctggtccctccaacatgcatggacaggggacagtgggactaacttcagtacccttggcctgcacagtagcaatgctgggagctagaggcagg
cagggcagttgggtcccttgccagctgctatggggcttaggccatgctcagtgctggggacaggagttttgcccaacgcagtgtcataaactgggttcat
gggcttacccattgggtgtgcgctcactgcttgggaagtgcagggggtcctgggcacattgccagctgggtgctgagcattgagtcactgatctcttgtg
atggggccaatgagtcaattgaattcatgggccaaacaggtcccatcctctgcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa