Human ORFeome, Internal ID: 6
BC number:  BC003352 UCSCBC052333 UCSCEntrez Gene ID:  7178
Length: 519Symbol:  TPT1
Resource Plate: GDEh81025Resource Plate Position:  H06
Lentiviral Plate: CCSBBroad304_092D1Lentiviral Position:  H05
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGATTATCTACCGGGACCT
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGTAACATTTTTCCATTTCTAAACCATCC
Description:  tumor protein, translationally-controlled 1 CHROMOSOME: 13
Template Information: 
Vendor Plate:  79Vendor Position:  C04
Collection:  Vendor Name: Open Biosystems
Vector: pCMV-SPORT6Catalog Number: 
Information Source: GENEBANK WEBSITE Library: NIH_MGC_68
Clone ID:  6058799 Genbank Accession: KJ892312
GI:  34189475, 30354509
MGC Coding Sequence: 
atgattatctaccgggacctcatcagccacgatgagatgttctccgacatctacaagatccgggagatcgcggacgggttgtgcctggaggtggagggga
agatggtcagtaggacagaaggtaacattgatgactcgctcattggtggaaatgcctccgctgaaggccccgagggcgaaggtaccgaaagcacagtaat
cactggtgtcgatattgtcatgaaccatcacctgcaggaaacaagtttcacaaaagaagcctacaagaagtacatcaaagattacatgaaatcaatcaaa
gggaaacttgaagaacagagaccagaaagagtaaaaccttttatgacaggggctgcagaacaaatcaagcacatccttgctaatttcaaaaactaccagt
tctttattggtgaaaacatgaatccagatggcatggttgctctattggactaccgtgaggatggtgtgaccccatatatgattttctttaaggatggttt
agaaatggaaaaatgttaa
cDNA Sequence (including UTRs): 
cgctcccccctccccccgagcgccgctccggctgcaccgcgctcgctccgagtttcaggctcgtgctaagctagcgccgtcgtcgtctcccttcagtcgc
catcatgattatctaccgggacctcatcagccacgatgagatgttctccgacatctacaagatccgggagatcgcggacgggttgtgcctggaggtggag
gggaagatggtcagtaggacagaaggtaacattgatgactcgctcattggtggaaatgcctccgctgaaggccccgagggcgaaggtaccgaaagcacag
taatcactggtgtcgatattgtcatgaaccatcacctgcaggaaacaagtttcacaaaagaagcctacaagaagtacatcaaagattacatgaaatcaat
caaagggaaacttgaagaacagagaccagaaagagtaaaaccttttatgacaggggctgcagaacaaatcaagcacatccttgctaatttcaaaaactac
cagttctttattggtgaaaacatgaatccagatggcatggttgctctattggactaccgtgaggatggtgtgaccccatatatgattttctttaaggatg
gtttagaaatggaaaaatgttaacaaatgtggcaattattttggatctatcacctgtcatcataactggcttctgcttgtcatccacacaacaccaggac
ttaagacaaatgggactgatgtcatcttgagctcttcatttattttgactgtgatttatttggagtggaggcattgtttttaagaaaaacatgtcatgta
ggttgtctaaaaataaaatgcatttaaactcaaaaaaaaaaaaaaaaaaaaaaaaaaa