Human ORFeome, Internal ID: 597
BC number:  BC018409 UCSCEntrez Gene ID:  92359
Length: 372Symbol:  CRB3
Resource Plate: GDEh81009Resource Plate Position:  B05
Lentiviral Plate: CCSBBroad304_089D1Lentiviral Position:  F03
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGCGAACCCCGGGCTG
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGTAGATGGGCAGGCAGCCCT
Description:  crumbs homolog 3 (Drosophila) CHROMOSOME: 19
Template Information: 
Vendor Plate:  16Vendor Position:  D05
Collection:  Vendor Name: Open Biosystems
Vector: pCMV-SPORT6Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_66 ovary tumor cell line
Clone ID:  3861124 Genbank Accession: KJ899945
GI:  17390964
MGC Coding Sequence: 
atggcgaaccccgggctggggctgcttctggcgctgggcctgccgttcctgctggcccgctggggccgagcctgggggcaaatacagaccacttctgcaa
atgagaatagcactgttttgccttcatccaccagctccagctccgatggcaacctgcgtccggaagccatcactgctatcatcgtggtcttctccctctt
ggctgccttgctcctggctgtggggctggcactgttggtgcggaagcttcgggagaagcggcagacggagggcacctaccggcccagtagcgaggagcag
ttctcccatgcagccgaggcccgggcccctcaggactccaaggagacggtgcagggctgcctgcccatctag
cDNA Sequence (including UTRs): 
accgagggttcgagggagggacacggaccaggaacctgagctaggtcaaagacgcccgggccaggtgccccgtcgcaggtgcccctggccggagatgcgg
taggaggggcgagcgcgagaagccccttcctcggcgctgccaacccgccacccagcccatggcgaaccccgggctggggctgcttctggcgctgggcctg
ccgttcctgctggcccgctggggccgagcctgggggcaaatacagaccacttctgcaaatgagaatagcactgttttgccttcatccaccagctccagct
ccgatggcaacctgcgtccggaagccatcactgctatcatcgtggtcttctccctcttggctgccttgctcctggctgtggggctggcactgttggtgcg
gaagcttcgggagaagcggcagacggagggcacctaccggcccagtagcgaggagcagttctcccatgcagccgaggcccgggcccctcaggactccaag
gagacggtgcagggctgcctgcccatctaggtcccctctcctgcatctgtctcccttcattgctgtgtgaccttggggaaaggcagtgccctctctgggc
agtcagatccacccagtgcttaatagcagggaagaaggtacttcaaagactctgcccctgaggtcaagagaggatggggctattcacttttatatattta
tataaaattagtagtgagatgtaaaaaaaaaaaaaaaaaaa