Human ORFeome, Internal ID: 586
BC number:  BC018345 UCSCEntrez Gene ID:  2872
Length: 477Symbol:  MKNK2
Resource Plate: GDEh81023Resource Plate Position:  C07
Lentiviral Plate: CCSBBroad304_090D1Lentiviral Position:  G04
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGCCCCGGAGGTAGTGGA
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCACTCATTCACAGTAACGGTTC
Description:  MAP kinase interacting serine/threonine kinase 2 CHROMOSOME: 19
Template Information: 
Vendor Plate:  16Vendor Position:  C02
Collection:  Vendor Name: Open Biosystems
Vector: pCMV-SPORT6Catalog Number: 
Information Source: GENEBANK WEBSITE Library: NIH_MGC_66 ovary tumor cell line
Clone ID:  3860516 Genbank Accession: KJ905207
GI:  17390806
MGC Coding Sequence: 
atggccccggaggtagtggaggccttcagcgaggaggctagcatctacgacaagcgctgcgacctgtggagcctgggcgtcatcttgtatatcctactca
gcggctacccgcccttcgtgggccgctgtggcagcgactgcggctgggaccgcggcgaggcctgccctgcctgccagaacatgctgtttgagagcatcca
ggagggcaagtacgagttccccgacaaggactgggcccacatctcctgcgctgccaaagacctcatctccaagctgctggtccgtgacgccaagcagagg
ctgagtgccgcccaagtcctgcagcacccctgggttcaggggtgcgccccggagaacaccttgcccactcccatggtcctgcagaggtgggacagtcact
tcctcctccctccccacccctgtcgcatccacgtgcgacctggaggactggtcagaaccgttactgtgaatgagtga
cDNA Sequence (including UTRs): 
tgcataacaaaggcatcgcccacagggacctaaagccggaaaacatcctctgtgagcaccccaaccaggtctcccccgtgaagatctgtgacttcgacct
gggcagcggcatcaaactcaacggggactgctcccctatctccaccccggagctgctcactccgtgcggctcggcggagtacatggccccggaggtagtg
gaggccttcagcgaggaggctagcatctacgacaagcgctgcgacctgtggagcctgggcgtcatcttgtatatcctactcagcggctacccgcccttcg
tgggccgctgtggcagcgactgcggctgggaccgcggcgaggcctgccctgcctgccagaacatgctgtttgagagcatccaggagggcaagtacgagtt
ccccgacaaggactgggcccacatctcctgcgctgccaaagacctcatctccaagctgctggtccgtgacgccaagcagaggctgagtgccgcccaagtc
ctgcagcacccctgggttcaggggtgcgccccggagaacaccttgcccactcccatggtcctgcagaggtgggacagtcacttcctcctccctccccacc
cctgtcgcatccacgtgcgacctggaggactggtcagaaccgttactgtgaatgagtgaagatcctggaggaccctgggccccaggccagctcccatcgc
tgggggacggtgaacggccatgtgttaatgttacgatgtttttaaaagacaaaaaaaaaaaaaaa