Human ORFeome, Internal ID: 5523
BC number:  BC005238 UCSCEntrez Gene ID:  5349
Length: 264Symbol:  FXYD3
Resource Plate: GDEh81004Resource Plate Position:  H04
Lentiviral Plate: CCSBBroad304_049D1Lentiviral Position:  G06
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGCAGAAGGTGACCCTGG
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCAGCTTTGGGCTGAGCCT
Description:  FXYD domain containing ion transport regulator 3 CHROMOSOME: 19
Template Information: 
Vendor Plate:  42Vendor Position:  A02
Collection:  Vendor Name: Open Biosystems
Vector: pDNR-LIBCatalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_53 bladder tumor cell line
Clone ID:  3997821 Genbank Accession: KJ891826
GI:  13528881
MGC Coding Sequence: 
atgcagaaggtgaccctgggcctgcttgtgttcctggcaggctttcctgtcctggacgccaatgacctagaagataaaaacagtcctttctactatgact
ggcacagcctccaggttggcgggctcatctgcgctggggttctgtgcgccatgggcatcatcatcgtcatgagtgcaaaatgcaaatgcaagtttggcca
gaagtccggtcaccatccaggggagactccacctctcatcaccccaggctcagcccaaagctga
cDNA Sequence (including UTRs): 
gatttctcccggaacctctgctcagcctggtgaaccacacaggccagcgctctgacatgcagaaggtgaccctgggcctgcttgtgttcctggcaggctt
tcctgtcctggacgccaatgacctagaagataaaaacagtcctttctactatgactggcacagcctccaggttggcgggctcatctgcgctggggttctg
tgcgccatgggcatcatcatcgtcatgagtgcaaaatgcaaatgcaagtttggccagaagtccggtcaccatccaggggagactccacctctcatcaccc
caggctcagcccaaagctgatgaggacagaccagctgaaattgggtggaggaccgttctctgtccccaggtcctgtctctgcacagaaacttgaactcca
ggatggaattcttcctcctctgctgggactcctttgcatggcagggcctcatctcacctctcgcaagagggtctctttgttcaattttttttaatctaaa
atgattgtgcctctccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa