Human ORFeome, Internal ID: 5273
BC number:  BC007611 UCSCBC014408 UCSCEntrez Gene ID:  79672
Length: 930Symbol:  FN3KRP
Resource Plate: GDEh81080Resource Plate Position:  H10
Lentiviral Plate: CCSBBroad304_161D1Lentiviral Position:  B03
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGAGGAGCTGCTGAGGC
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCACTTGACCAGATTCCTCATGATGTT
Description:  fructosamine 3 kinase related protein CHROMOSOME: 17
Template Information: 
Vendor Plate:  38Vendor Position:  F01
Collection:  Vendor Name: Open Biosystems
Vector: pOTB7Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_16 retinoblastoma cell line
Clone ID:  3351601 Genbank Accession: KJ905535
GI:  15680130, 14043241
MGC Coding Sequence: 
atggaggagctgctgaggcgcgagctgggctgcagctctgtcagggccacgggccactcggggggcgggtgcatcagccagggccggagctacgacacgg
atcaaggacgagtgttcgtgaaagtgaaccccaaggcggaggccagaagaatgtttgaaggtgagatggcaagtttaactgccatcctgaaaacaaacac
ggtgaaagtgcccaagcccatcaaggttctggatgccccaggcggcgggagcgtgctggtgatggagcacatggacatgaggcatctgagcagtcatgct
gcaaagcttggagcccagctggccgatttacaccttgataacaagaagcttggagagatgcgcctgaaggaggcgggcacagtggggagaggaggtgggc
aggaggaacggccctttgtggcccggtttggatttgacgtggtgacgtgctgtggatacctcccccaggtgaatgactggcaggaggactgggtcgtgtt
ctatgcccggcagcgcattcagccccagatggacatggtggagaaggagtctggggacagggaggccctccagctttggtctgctctgcagttaaagatc
cctgacctgttccgtgacctggagatcatcccagccttactccacggggacctctggggtggaaacgtagcagaggattcctctgggccggtgatttttg
acccagcttctttctacggccactcggaatatgagctggcaatagctggcatgtttgggggctttagcagctccttttactccgcctaccacggcaaaat
ccccaaggccccaggattcgagaagcgccttcagttgtatcagctctttcactacttgaaccactggaatcattttggatcggggtacagaggatcctcc
ctgaacatcatgaggaatctggtcaagtga
cDNA Sequence (including UTRs): 
ggcgggtccgcggccgcggcgggaacatggaggagctgctgaggcgcgagctgggctgcagctctgtcagggccacgggccactcggggggcgggtgcat
cagccagggccggagctacgacacggatcaaggacgagtgttcgtgaaagtgaaccccaaggcggaggccagaagaatgtttgaaggtgagatggcaagt
ttaactgccatcctgaaaacaaacacggtgaaagtgcccaagcccatcaaggttctggatgccccaggcggcgggagcgtgctggtgatggagcacatgg
acatgaggcatctgagcagtcatgctgcaaagcttggagcccagctggccgatttacaccttgataacaagaagcttggagagatgcgcctgaaggaggc
gggcacagtggggagaggaggtgggcaggaggaacggccctttgtggcccggtttggatttgacgtggtgacgtgctgtggatacctcccccaggtgaat
gactggcaggaggactgggtcgtgttctatgcccggcagcgcattcagccccagatggacatggtggagaaggagtctggggacagggaggccctccagc
tttggtctgctctgcagttaaagatccctgacctgttccgtgacctggagatcatcccagccttactccacggggacctctggggtggaaacgtagcaga
ggattcctctgggccggtgatttttgacccagcttctttctacggccactcggaatatgagctggcaatagctggcatgtttgggggctttagcagctcc
ttttactccgcctaccacggcaaaatccccaaggccccaggattcgagaagcgccttcagttgtatcagctctttcactacttgaaccactggaatcatt
ttggatcggggtacagaggatcctccctgaacatcatgaggaatctggtcaagtgagcgggccttactctggaaggaggcctcagaggtttctccacagt
cctcttctgggcaaattcttgtttcttcacatgccggactagcttaagaccaatgcagtagcttatttccaagccttgcaaagtatataatatctaagag
gaaaggttttgtcatcccagcgttgtccactttgtggggctttgtaggtagacggagccacactacaggcagggtatgagcagagggatgtatggagtgt
gggtgactctgagcctcactgctgctgcaaggtggggaaactgtaagtgaacccctgtgggtgcgggggagggtatccggtgcacagggaggtggccagc
gcccccgggcactgctgctcataggtacctttccgctgcctcctccctgctctcctgtgcaggaatgtctctgagctgttcacgttgatgcttcttggtt
ggcaagacttgggtgtagatatgaaaccatcttactaaaagcgtcttaaaatgaccaattccagaatcaagcgtattccgttttcttcctgcatgatcct
gggccctcccgcaggctgagcaagtctgtaaactgattctgggagaaaccaagctgctggccgtagggtgtccttgggtacatccaggagtcttcattgc
ttctgttattaccccgtctcctctgccattttctacagcttgctgagttgtcattcctttgcaacattaaaatacatgctgaactcatatttttccttcc
ttcactgttgtagtaaagagacatatttcatgaatggcattgatgctaataaatcctttgcacaaaaaaaaaaaaaaaaaa