Human ORFeome, Internal ID: 5258
BC number:  BC007286 UCSCEntrez Gene ID:  339500
Length: 249Symbol:  ZNF678
Resource Plate: GDEh81133Resource Plate Position:  G02
Lentiviral Plate: CCSBBroad304_049D1Lentiviral Position:  F07
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGTTGACCTGCTTTCCATGTCT
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGTAGGCTCCTAACCAGGACTT
Description:  zinc finger protein 678 CHROMOSOME: 1
Template Information: 
Vendor Plate:  38Vendor Position:  D01
Collection:  Vendor Name: Open Biosystems
Vector: pOTB7Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_16 retinoblastoma cell line
Clone ID:  3344302 Genbank Accession: KJ904195
GI:  13938314
MGC Coding Sequence: 
atggttgacctgctttccatgtctcaaaacattagtccctacaagaaccctatgaggtttatcttcttttcacccattttgagagaagaaaagttcagct
cagagagctgcaggaacattggggacatctccaagtcacagccaataggtggcagtcatcagtgtgtcttggaagggacaaacattgagcttctgaacag
ctactccagaaactatggtgctgtggtgaagtcctggttaggagcctag
cDNA Sequence (including UTRs): 
ctcagatattttgttgaacgtgggacctttgtttttttttgttgttttgttttgttttgtttttgttgttgttgttgttgttgtttaccagcaggggacc
cctgttttgtctatgtcaagaacaaagaccaggcaaaagaaatgtcaagccgcatttacaaatgcaaaaatggacttgtttttgatatgcttttcccaac
aataagggacatgagtcattggggcatgttacagagagtttcagtaaaattcagaaaaaaataataaatatgaacagccacagcatgcccagaagccttt
ttatggagccaggcatggttgacctgctttccatgtctcaaaacattagtccctacaagaaccctatgaggtttatcttcttttcacccattttgagaga
agaaaagttcagctcagagagctgcaggaacattggggacatctccaagtcacagccaataggtggcagtcatcagtgtgtcttggaagggacaaacatt
gagcttctgaacagctactccagaaactatggtgctgtggtgaagtcctggttaggagcctaggaaaatggtgaaggaaaagatggtcccagcctgcaaa
gctgaagtcaggaacccaccaggatctcccttctccctagcctggtggtccacatcatgcagatttactctagattcagcttagactcatttttatacta
ctcgggggacaaggagggaactacagtcagtaacagcagcatgagcctcaggtgctttggggattgaaattcagaccaggaaattccaatacatcagtgc
atgtggaggacatgagtatttaaggagaaggttctaggcttccgaagtaaaattggatgtggaggttggggattgattcaaacattaatactttcaagcg
tttctatggtatttgtcagctgtggagcaacagcacacatctgtattaatagcctgtgttaagagattactgtgaatcctgaaaaacatcctcattgtag
agatgagaaaacacaggcttttgcacatccaatgtctccttaaagcatgtggttcagaattgagaacgtgcagagtgagagtggtatgaattttcctgta
agctacctgaagttctgtttgctgtcatgtggaagaaaagagccttggagaagttttatttttttctgtttggaaagaatacccagagcaagatgatttc
caataacccttttgccctaccgcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa