Human ORFeome, Internal ID: 5227
BC number:  BC007622 UCSCBC008703 UCSCEntrez Gene ID:  85012
Length: 603Symbol:  TCEAL3
Resource Plate: GDEh81102Resource Plate Position:  H02
Lentiviral Plate: CCSBBroad304_023D1Lentiviral Position:  H03
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGAAAAACCCTACAATAAAAATGAAGGA
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGTAAAGGTATGGGATATCGTGTAAG
Description:  transcription elongation factor A (SII)-like 3 CHROMOSOME: X
Template Information: 
Vendor Plate:  38Vendor Position:  H04
Collection:  Vendor Name: Open Biosystems
Vector: pOTB7Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_16 retinoblastoma cell line
Clone ID:  3355622 Genbank Accession: KJ895073
GI:  14250511, 14043261
MGC Coding Sequence: 
atggaaaaaccctacaataaaaatgaaggaaacctggaaaacgagggaaagccagaagatgaagtagagcctgatgatgaaggaaagtcagacgaggaag
aaaagccagacgtggaggggaagacagaatgcgagggaaagagagaggatgagggagagccaggtgatgagggacaactggaagatgagggaagccagga
aaagcagggcaggtccgaaggtgagggcaagccacaaggcgagggcaagccagcctcccaggcaaagccagagagccagccgcgggccgccgaaaagcgc
ccggctgaagattatgtgccccggaaagcaaaaagaaaaacggacagggggacggacgattcccccaaggactctcaggaggacttacaggaaaggcatc
tgagcagtgaggagatgatgagagaatgtggagatgtgtcaagggctcaagaggagctaaggaaaaaacagaaaatgggtggttttcattggatgcaaag
agatgtacaggatccattcgccccaaggggacaacggggtgtcaggggagtgaggggtggaggtaggggccagaggggcttacacgatatcccatacctt
taa
cDNA Sequence (including UTRs): 
agcccccgcgcccgcccgcccgccctgcggtccggtcctggcgcccgcgcagaaccagctgtctgagctgcccgggcagcgggggagcagcgagcgggct
tccgcgagccggagaaggcacaggcctgtcccgggtcccggcaggtctgcgcgtctgttcccagcgctctgcgaggcctaaaaaggaggagcaacctgtc
cagaatccctgcaggacaggaaaaggaggggaaatctcgacatggaaaaaccctacaataaaaatgaaggaaacctggaaaacgagggaaagccagaaga
tgaagtagagcctgatgatgaaggaaagtcagacgaggaagaaaagccagacgtggaggggaagacagaatgcgagggaaagagagaggatgagggagag
ccaggtgatgagggacaactggaagatgagggaagccaggaaaagcagggcaggtccgaaggtgagggcaagccacaaggcgagggcaagccagcctccc
aggcaaagccagagagccagccgcgggccgccgaaaagcgcccggctgaagattatgtgccccggaaagcaaaaagaaaaacggacagggggacggacga
ttcccccaaggactctcaggaggacttacaggaaaggcatctgagcagtgaggagatgatgagagaatgtggagatgtgtcaagggctcaagaggagcta
aggaaaaaacagaaaatgggtggttttcattggatgcaaagagatgtacaggatccattcgccccaaggggacaacggggtgtcaggggagtgaggggtg
gaggtaggggccagaggggcttacacgatatcccatacctttaatgcctttggccttccattctgatttctctgatgagaatattgctggccctgctttc
cctggtaggtatttgccaggcccaatgctttaaccttaagctgatactttgctttagatgtcagtctcgttaccagcagccttttgacccaactacggcg
ctctatattttagtagaggattttcacccatgtgcatggaaaagatgttcatggtacattgtaaaaaaaaaaaaaaaaaa