Human ORFeome, Internal ID: 5145
BC number:  BC007891 UCSCEntrez Gene ID:  51540
Length: 1338Symbol:  SCLY
Resource Plate: GDEh81084Resource Plate Position:  C04
Lentiviral Plate: CCSBBroad304_018D1Lentiviral Position:  E03
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGAGGCGGCCGTGGCGCC
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGTAGGCCTGGTCCTCCAGC
Description:  selenocysteine lyase CHROMOSOME: 2
Template Information: 
Vendor Plate:  36Vendor Position:  D02
Collection:  Vendor Name: Open Biosystems
Vector: pOTB7Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_19 neuroblastoma cell line
Clone ID:  4126478 Genbank Accession: KJ898918
GI:  39644567
MGC Coding Sequence: 
atggaggcggccgtggcgccggggagggatgcgccggcacccgcggcgagtcagcccagcggctgcgggaaacacaactcgccggagaggaaagtttata
tggactataatgcaacgactcccctggagccagaagttatccaggccatgaccaaggccatgtgggaagcctggggaaatcccagcagcccgtattcagc
aggaagaaaggccaaggatattataaatgcagctcgggaaagcctcgcgaagatgataggggggaaacctcaagatataatcttcacttccgggggcact
gagtcaaataatttagtaatccattctgtggtgaaacatttccacgcaaaccagacctcaaagggacacacaggtgggcaccacagcccagtgaaggggg
ccaagccccatttcattacttcctcggtggaacacgactccatccggctgcccctggagcacctggtggaagaacaagtggcagcggtcacctttgtccc
ggtgtccaaggtgagcgggcagacagaggtggacgacatcctcgcggcagtccgcccgaccacacgcctcgtgaccatcatgctggccaacaatgagact
ggcattgtcatgcctgtccctgaaatcagtcagcgcattaaagccctgaaccaggaacgggtggcagctgggctacctcccatcctcgtgcacacggatg
ctgcacaggccttggggaagcagcgcgtggatgtggaggacctgggcgtggacttccttacaatcgtggggcacaagttttatggtcccaggattggcgc
actttatatacgaggacttggtgaatttacccctctctaccctatgctatttggaggtggacaagaacggaatttcaggccagggacagagaacacccca
atgattgctggccttgggaaggccgcggagctggtgacccagaactgcgaggcttatgaggcccacatgagggacgtccgcgactacctggaagagaggc
tggaagctgaattcggtcagaagagaatccatctgaatagccagtttccaggcacccagcggcttcccaatacctgtaacttttccatccggggaccccg
gcttcaaggccacgtggtgcttgcgcagtgccgagtgctgatggccagtgtgggggccgcgtgccactcggaccacggggaccagccgtccccagtgctg
ctgagctacggtgtccccttcgacgtggccaggaacgcgctccggctcagcgtgggccgcagcaccaccagggccgaggtggacctcgtcgtgcaggacc
tgaagcaggccgtggcgcagctggaggaccaggcctag
cDNA Sequence (including UTRs): 
cagcagtggggcggggatggaggcggccgtggcgccggggagggatgcgccggcacccgcggcgagtcagcccagcggctgcgggaaacacaactcgccg
gagaggaaagtttatatggactataatgcaacgactcccctggagccagaagttatccaggccatgaccaaggccatgtgggaagcctggggaaatccca
gcagcccgtattcagcaggaagaaaggccaaggatattataaatgcagctcgggaaagcctcgcgaagatgataggggggaaacctcaagatataatctt
cacttccgggggcactgagtcaaataatttagtaatccattctgtggtgaaacatttccacgcaaaccagacctcaaagggacacacaggtgggcaccac
agcccagtgaagggggccaagccccatttcattacttcctcggtggaacacgactccatccggctgcccctggagcacctggtggaagaacaagtggcag
cggtcacctttgtcccggtgtccaaggtgagcgggcagacagaggtggacgacatcctcgcggcagtccgcccgaccacacgcctcgtgaccatcatgct
ggccaacaatgagactggcattgtcatgcctgtccctgaaatcagtcagcgcattaaagccctgaaccaggaacgggtggcagctgggctacctcccatc
ctcgtgcacacggatgctgcacaggccttggggaagcagcgcgtggatgtggaggacctgggcgtggacttccttacaatcgtggggcacaagttttatg
gtcccaggattggcgcactttatatacgaggacttggtgaatttacccctctctaccctatgctatttggaggtggacaagaacggaatttcaggccagg
gacagagaacaccccaatgattgctggccttgggaaggccgcggagctggtgacccagaactgcgaggcttatgaggcccacatgagggacgtccgcgac
tacctggaagagaggctggaagctgaattcggtcagaagagaatccatctgaatagccagtttccaggcacccagcggcttcccaatacctgtaactttt
ccatccggggaccccggcttcaaggccacgtggtgcttgcgcagtgccgagtgctgatggccagtgtgggggccgcgtgccactcggaccacggggacca
gccgtccccagtgctgctgagctacggtgtccccttcgacgtggccaggaacgcgctccggctcagcgtgggccgcagcaccaccagggccgaggtggac
ctcgtcgtgcaggacctgaagcaggccgtggcgcagctggaggaccaggcctagcactggggccgccttccccaccccgcttctgggaagcccgtggcag
ggcacagggttgtccctccagttccctcctgagggctgtgccaggatgactgtctcatgccccctctgcattttgtcctggagtgccagcgagtgtgcac
ccccagtttccttccctggaaccctgcagagctcacagggcccaggacaccaacgccgcataggaccgcccacatgggaacgcccacatgggaccgccca
cataggaccgcccacataggaccgcccacatgggaccgcccacatagaaccgcccacataggaccgcccacatgggaacgcccacatgggaccgcccaca
tgggaccgcccacatgggaccgcccacatagaaccgtcctccagtggtgaagcggaaacacttagctttatccaccctccccactgggaactgggcacgc
ctgttgtgagtgccctttcctggaaggtgtttttatctggaagatagaatccaagtatttataactcattgtcagccaaatgctatcatgaacgtaggaa
acttgatttttttgttttgatcatggcctctacatgcacctttccagagtggtctcttctcgggccctttttagtccctttccaaagctgcccccaccac
cctgctcctctggcctcagtgcacagtggcccccagcctcggccaggcctgctctgctcagcgcccaccgcccaccacccctcctgcttccccgagcctg
accctgttccgcccactggcaatcagggctgcgcacttccctgtccacggtccccaggccttcctgtcttgtcccttttgatcattaactcagggtttca
gctccaacctcgctgagttggtgcagctccgggtcattcctggggtgggaatcggatcatccctgactcagcttataccttaattttatttgcagaggat
tcttttctcaaaatgctctggcatttggacacacatcacatgtcgatatttgcataggagtcattttcagtggaataacatttttaatgtgtggttttac
ggttcaaggaactacatgatgattttgaggaaacacttgccagaaactaaattaacgaataaaagatttcagtgcccgaaaaaaaaaaaaaaaaaa