Human ORFeome, Internal ID: 5131
BC number:  BC007928 UCSCEntrez Gene ID:  84996
Length: 186Symbol:  C21orf119
Resource Plate: GDEh81002Resource Plate Position:  H06
Lentiviral Plate: CCSBBroad304_058D1Lentiviral Position:  B09
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGGGCGAGCGGACACT
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCATTGTGCTGCTTGGACG
Description:  chromosome 21 open reading frame 119 CHROMOSOME: 21
Template Information: 
Vendor Plate:  36Vendor Position:  B06
Collection:  Vendor Name: Open Biosystems
Vector: pOTB7Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_7 lung tumor cell line
Clone ID:  3945901 Genbank Accession: KJ900883
GI:  14043993
MGC Coding Sequence: 
atggggcgagcggacactccacgacaccccccgcccccggctgcagggtttggggtccaccggggcgcatttctgatcccagtggctcttcgggtgctct
tggccggaagaactcccagacctttcactcctggcctggccgatccacgaagactcgggccccggcgcgtccaagcagcacaatga
cDNA Sequence (including UTRs): 
acgaggaggggcggggcgatagggatccagagtcttggggatccagagtcttggggctccatgtgagtttgctgtaccggttgtcccggtcacggcatgg
ggcgagcggacactccacgacaccccccgcccccggctgcagggtttggggtccaccggggcgcatttctgatcccagtggctcttcgggtgctcttggc
cggaagaactcccagacctttcactcctggcctggccgatccacgaagactcgggccccggcgcgtccaagcagcacaatgagtagttcttgacccgagg
tcgccctgaaggtgtcgcatgaagagcttgcttcacacacaacaggattcgatactttgccaattcaaggccctggtggctggccgggaaggtggattcg
ccttggctaggtgccaggcaggtccgcctgtgcgggtgcccctgacttcgacccctagcttatgtcacagcccgaaccagatcgactggtctggtagcag
cctgtcactccagactgtcctccaccccagacttccgcaaactgatgggctctttgcgccgtgcagggtgggaggagaagaccaaacgaagtaacgtctg
taaaaccccttcctggacagcgtaaggcctccacatctaagttcctgtcattaaaatggagacagcaaagccgaccctatccagtccttgggactgttat
gaacagaaaatgatgcaatgtatgaaaaactgctttgaggagaaaaacaacacagtgtgtttttggaagatgtgattgatttgtaaaccgcattaaatgc
tctgaaataaaatgaaagtaaaaataaaaaaaaaaaaaaaaaaa