Human ORFeome, Internal ID: 5005
BC number:  BC005058 UCSCEntrez Gene ID:  84278
Length: 258Symbol:  HIATL2
Resource Plate: GDEh81004Resource Plate Position:  C06
Lentiviral Plate: CCSBBroad304_058D1Lentiviral Position:  E03
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGTTGACTGTTCTACATGAAACATT
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCAAGCCATTCTCCTGCCAC
Description:  hippocampus abundant transcript-like 2 CHROMOSOME: 9
Template Information: 
Vendor Plate:  34Vendor Position:  D02
Collection:  Vendor Name: Open Biosystems
Vector: pOTB7Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_20 melanoma cell line
Clone ID:  2906049 Genbank Accession: KJ900870
GI:  13477192
MGC Coding Sequence: 
atgttgactgttctacatgaaacattttctcaacacacattcctcatgaatggtctcattcaaggtgtaaagggcctgctctcttttttgagtgccccac
tcattggtgccctgtctgatgtgtgggggaggaagccctttctcctcggcactgtattctttacctgcttcccaatcccactgatgaggatcagcccatg
ccgggtgtggtggcgtgcacctgtagtcccagctacctgtggcaggagaatggcttga
cDNA Sequence (including UTRs): 
gcggtttgctaagtggtcggttcctggagctgcggtcttctgctagcctgatccgcagcttcagcctccgccgcctcctcagccctcggcgccgccgcct
gacccgcaggccgccgcgggccgcagagcccatgagggcgcgggcaccgccgccgcctccgcggcgtcgccgtcgtcccggagcgccccgagctggcgcg
ggcatggccgcggcatgagcgtggagccgccgccggagctggaggagaaggcggcgtcggagcccgaggcgggagccatgccggagaagcgcgcgggcgc
gcaggccgcggggagcacctggctacaaggctttggcccaccaagtgtgtaccatgctgctattgtcatcttccttgaattctttgcgtggggccttttg
acaactccaatgttgactgttctacatgaaacattttctcaacacacattcctcatgaatggtctcattcaaggtgtaaagggcctgctctcttttttga
gtgccccactcattggtgccctgtctgatgtgtgggggaggaagccctttctcctcggcactgtattctttacctgcttcccaatcccactgatgaggat
cagcccatgccgggtgtggtggcgtgcacctgtagtcccagctacctgtggcaggagaatggcttgaacccaggaagcggaggttgcagtgagccaagat
cacaccattgcactccagcctaggcatggtgagactccatctcaaaaaaaaaaaaaaattaaattgtattgattttctcttttcaaaaaaaaaaaaaaaa
aa