Human ORFeome, Internal ID: 4865
BC number:  BC006290 UCSCBC030994 UCSCBC069526 UCSC
Entrez Gene ID:  94115
Length: 498Symbol:  CGB8
Resource Plate: GDEh81024Resource Plate Position:  H06
Lentiviral Plate: CCSBBroad304_092D1Lentiviral Position:  E02
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGAGATGTTCCAGGGG
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGTATTGTGGGAGGATCGGGGT
Description:  chorionic gonadotropin, beta polypeptide 8 CHROMOSOME: 19
Template Information: 
Vendor Plate:  89Vendor Position:  E02
Collection:  Vendor Name: Open Biosystems
Vector: pDNR-LIBCatalog Number: 
Information Source: GENEBANK WEBSITE Library: NIH_MGC_79
Clone ID:  4605021 Genbank Accession: KJ895214
GI:  47480999, 33991111, 21411320
MGC Coding Sequence: 
atggagatgttccaggggctgctgctgttgctgctgctgagcatgggcgggacatgggcatccaaggagccgcttcggccacggtgccgccccatcaatg
ccaccctggctgtggagaaggagggctgccccgtgtgcatcaccgtcaacaccaccatctgtgccggctactgccccaccatgacccgcgtgctgcaggg
ggtcctgccggccctgcctcaggtggtgtgcaactaccgcgatgtgcgcttcgagtccatccggctccctggctgcccgcgcggcgtgaaccccgtggtc
tcctacgccgtggctctcagctgtcaatgtgcactctgccgccgcagcaccactgactgcgggggtcccaaggaccaccccttgacctgtgatgaccccc
gcttccaggactcctcttcctcaaaggcccctccccccagccttccaagtccatcccgactcccggggccctcggacaccccgatcctcccacaataa
cDNA Sequence (including UTRs): 
agtccagcacctttctcgggtcacggcctcctcctggctcccaggaccccaccataggcagaggcaggccttcctacaccctactccctgtgcctccagg
cttgactagtccctagcactcgacgactgagtctctgaggtcacttcaccgtggtctccgcctcacccttggcgctggaccagtgagaggagagggctgg
ggcgctccgctgagccactcctgcgcccccctggccttgtctacctcttgccccccgaagggttagtgtcgagctcactccagcatcctacaacctcctg
gtggccttgccgcccccacaaccccgaggtttaaagccaggtacacgaggcaggggacacaccaaggatggagatgttccaggggctgctgctgttgctg
ctgctgagcatgggcgggacatgggcatccaaggagccgcttcggccacggtgccgccccatcaatgccaccctggctgtggagaaggagggctgccccg
tgtgcatcaccgtcaacaccaccatctgtgccggctactgccccaccatgacccgcgtgctgcagggggtcctgccggccctgcctcaggtggtgtgcaa
ctaccgcgatgtgcgcttcgagtccatccggctccctggctgcccgcgcggcgtgaaccccgtggtctcctacgccgtggctctcagctgtcaatgtgca
ctctgccgccgcagcaccactgactgcgggggtcccaaggaccaccccttgacctgtgatgacccccgcttccaggactcctcttcctcaaaggcccctc
cccccagccttccaagtccatcccgactcccggggccctcggacaccccgatcctcccacaataaaggcttctcaatccacaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaa