Human ORFeome, Internal ID: 4850
BC number:  BC006223 UCSCEntrez Gene ID:  84309
Length: 636Symbol:  NUDT16L1
Resource Plate: GDEh81031Resource Plate Position:  H10
Lentiviral Plate: CCSBBroad304_105D1Lentiviral Position:  C11
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGTCGACGGCGGCGGTT
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCAAGAGGAGGCCGGGAGCAA
Description:  nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1 CHROMOSOME: 16
Template Information: 
Vendor Plate:  32Vendor Position:  B04
Collection:  Vendor Name: Open Biosystems
Vector: pOTB7Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_7 lung tumor cell line
Clone ID:  3944355 Genbank Accession: KJ894977
GI:  39644484
MGC Coding Sequence: 
atgtcgacggcggcggttccggagctgaagcagatcagccgggtggaggcgatgcgcctagggccgggctggagccactcgtgccacgccatgctgtacg
ccgccaaccctgggcagctcttcggccgcatccccatgcgcttctcggtgctgatgcagatgcgtttcgacgggctgctgggcttccccgggggcttcgt
ggaccggcgcttctggtcgctggaggacggcctgaaccgggtgctgggcctgggcctgggctgcctgcgcctcaccgaggccgactacctgagctcgcac
ctgaccgagggcccacaccgcgtcgtggcgcacctgtacgcgcggcagctgacgctggagcagctgcacgccgtggagatcagcgcggtgcactcgcgcg
accacggcctggaggtgctgggcctcgtgcgggtcccgctgtacacccagaaggaccgagtcggaggcttccccaacttcctgagcaacgccttcgtgag
cacggctaagtgccagctcctctttgccctcaaggtgctcaacatgatgcccgaggagaagctggttgaggccctggctgcagccaccgagaagcagaag
aaggccctggagaagttgctcccggcctcctcttga
cDNA Sequence (including UTRs): 
gtcagtgccaagatgtcgacggcggcggttccggagctgaagcagatcagccgggtggaggcgatgcgcctagggccgggctggagccactcgtgccacg
ccatgctgtacgccgccaaccctgggcagctcttcggccgcatccccatgcgcttctcggtgctgatgcagatgcgtttcgacgggctgctgggcttccc
cgggggcttcgtggaccggcgcttctggtcgctggaggacggcctgaaccgggtgctgggcctgggcctgggctgcctgcgcctcaccgaggccgactac
ctgagctcgcacctgaccgagggcccacaccgcgtcgtggcgcacctgtacgcgcggcagctgacgctggagcagctgcacgccgtggagatcagcgcgg
tgcactcgcgcgaccacggcctggaggtgctgggcctcgtgcgggtcccgctgtacacccagaaggaccgagtcggaggcttccccaacttcctgagcaa
cgccttcgtgagcacggctaagtgccagctcctctttgccctcaaggtgctcaacatgatgcccgaggagaagctggttgaggccctggctgcagccacc
gagaagcagaagaaggccctggagaagttgctcccggcctcctcttgagggctgcctgagctggtggcaccctcccctgggccggaagactgggaattcc
tgctaagtgtggcttctagagtgtttgtgtgtaccccgcttctgactgcctagggcgagtgggcatcctgtcatcatctccactgtcccaagcagtcact
aggtggcggccgggccagctggaacccagcccatcctctcaggcagagcagggtggtccgggcacactgggcctgcctctccagcctcaggatgctcttg
tttattctgggctcagaccctcctcttgtacgtctcatcacagctggtagagacccaggagtgcctgattgtcccacaggggtggcgcacagctctggga
ccactcagaagatgggatgtgtgggtggaggatgccttgtctcggtcagctcattcctgcctccttcctgagccagttcagggcctgggggagagccagc
ttggggtaggaagttaataatactgttaatttgggttgttgttggatttactttgctagattttctctttcaccacgtgtgaactgtgggtgaggtttca
aagtagcttcaccccacgtggcttggttcccagggacagtcagggcctcgggggcccagctatgtacaacgaagctgtcgaaggagaagacaataaagtc
gctccgcagctgcaaaaaaaaaaaaaaaaaaaaaaaaaaaa