Human ORFeome, Internal ID: 4813
BC number:  BC006229 UCSCEntrez Gene ID:  1329
Length: 390Symbol:  COX5B
Resource Plate: GDEh81010Resource Plate Position:  A05
Lentiviral Plate: CCSBBroad304_091D1Lentiviral Position:  H09
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGCTTCAAGGTTACTTCG
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCAGTGTGCCAGCTGCTGGG
Description:  cytochrome c oxidase subunit Vb CHROMOSOME: 2
Template Information: 
Vendor Plate:  31Vendor Position:  F03
Collection:  Vendor Name: Open Biosystems
Vector: pOTB7Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_20 melanoma cell line
Clone ID:  3952882 Genbank Accession: KJ890956
GI:  38197026
MGC Coding Sequence: 
atggcttcaaggttacttcgcggagctggaacgctggccgcgcaggccctgagggctcgcggccccagtggcgcggccgcgatgcgctccatggcatctg
gaggtggtgttcccactgatgaagagcaggcgactgggttggagagggagatcatgctggctgcaaagaagggactggacccatacaatgtactggcccc
aaagggagcttcaggcaccagggaagaccctaatttagtcccctccatctccaacaagagaatagtaggctgcatctgtgaagaggacaataccagcgtc
gtctggttttggctgcacaaaggcgaggcccagcgatgcccccgctgtggagcccattacaagctggtgccccagcagctggcacactga
cDNA Sequence (including UTRs): 
cggaagttttgctgctagtcgcggacgcaatggcttcaaggttacttcgcggagctggaacgctggccgcgcaggccctgagggctcgcggccccagtgg
cgcggccgcgatgcgctccatggcatctggaggtggtgttcccactgatgaagagcaggcgactgggttggagagggagatcatgctggctgcaaagaag
ggactggacccatacaatgtactggccccaaagggagcttcaggcaccagggaagaccctaatttagtcccctccatctccaacaagagaatagtaggct
gcatctgtgaagaggacaataccagcgtcgtctggttttggctgcacaaaggcgaggcccagcgatgcccccgctgtggagcccattacaagctggtgcc
ccagcagctggcacactgagcacctgcactaaattactcaaaatgtgctgtaaagtttcttctttccagtaaagactagccattgcattggctccttctc
ccataaaaaaaaaaaaaaaaaaa