Human ORFeome, Internal ID: 4243
BC number:  BC004269 UCSCEntrez Gene ID:  84734
Length: 225Symbol:  FAM167B
Resource Plate: GDEh81003Resource Plate Position:  A07
Lentiviral Plate: CCSBBroad304_058D1Lentiviral Position:  C10
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGCAGGCGCAGGACAGG
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCAGCAGAGGGTGAAGCGCC
Description:  family with sequence similarity 167, member B CHROMOSOME: 1
Template Information: 
Vendor Plate:  23Vendor Position:  B04
Collection:  Vendor Name: Open Biosystems
Vector: pOTB7Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_20 melanoma cell line
Clone ID:  3613742 Genbank Accession: KJ903453
GI:  13279076
MGC Coding Sequence: 
atgcaggcgcaggacaggcagctggcagggcagctgctgcggctgcgggcccagctgcaccgactgaagatggaccaagcctgtcacctgcaccaggagc
tgctggatgaggccgagctggagctggagctggagcccggggccggcctagccctggccccgctgctgcggcacctgggcctcacgcgcatgaacatcag
cgcccggcgcttcaccctctgctga
cDNA Sequence (including UTRs): 
cacacacccatctgctcactcaccctggcacattcagcccccctaacccaccttgaacattgaccaccacacactccctggcacgctcttctcaccctca
acttctgccacctctccctgggcaatactgccagcctttccctaatctcagagctgcagccctgccctgtcactcacctcaaacctgccatgtccctggg
gctactgaaattccaggcagtgggtgaagaggacgaggaggatgaggagggggagagcctggactctgtgaaggcactgacagccaagctgcagctgcag
actcggcggccctcatatctggagtggacagcccaggtccagagccaggcctggcgcagggcccaagccaaacctggaccagggggacctggggacatct
gtggtttcgactcaatggactccgcccttgagtggctccgacgggagctgcgggagatgcaggcgcaggacaggcagctggcagggcagctgctgcggct
gcgggcccagctgcaccgactgaagatggaccaagcctgtcacctgcaccaggagctgctggatgaggccgagctggagctggagctggagcccggggcc
ggcctagccctggccccgctgctgcggcacctgggcctcacgcgcatgaacatcagcgcccggcgcttcaccctctgctgaggaacacctgtgccccccg
actccccgccccctctcccaatgccgcttcccctgcctgcctgggaagaggaaagggaggggtgccccagaggcaccagctcctggcgggggaggaggaa
cattcaggtttctgagagctgaattccaagagtgcaaaaccccagcatcctgtttcctctgctgacccagctgggagggggaggaggaggagctcacacc
ctcaaactcctcaataaacgctttctctggttcccaaaaaaaaaaaaaaaaaaaaaaaa