Human ORFeome, Internal ID: 4088
BC number:  BC002640 UCSCEntrez Gene ID:  90410
Length: 447Symbol:  IFT20
Resource Plate: GDEh81012Resource Plate Position:  F04
Lentiviral Plate: CCSBBroad304_062D1Lentiviral Position:  A09
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGCCAAGGACATCCTGGGTGAA
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCAACCCGATACCTTTCTAGCTGCAT
Description:  intraflagellar transport 20 homolog (Chlamydomonas) CHROMOSOME: 17
Template Information: 
Vendor Plate:  21Vendor Position:  A05
Collection:  Vendor Name: Open Biosystems
Vector: pOTB7Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_44 uterine tumor cell line
Clone ID:  3609552 Genbank Accession: KJ895120
GI:  33876964
MGC Coding Sequence: 
atggccaaggacatcctgggtgaagcagggctacactttgatgaactgaacaagctgagggtgttggacccagaggttacccagcagaccatagagctga
aggaagagtgcaaagactttgtggacaaaattggccagtttcagaaaatagttggtggtttaattgagcttgttgatcaacttgcaaaagaagcagaaaa
tgaaaagatgaagagtcttgctgtgtcacccaggctggagtgcactggtgcaatctcggctcactgcaagctctgcctctcagattcaagcgattctccc
acctcaccctcccgagtaggtgggactacaggccatcggtgctcggaacttgctcaaatctatagcaaagcagagagaagctcaacagcagcaacttcaa
gccctaatagcagaaaagaaaatgcagctagaaaggtatcgggttga
cDNA Sequence (including UTRs): 
ggtaaacaggctctgtatccgtggcagcggccgtggcaggctggctgggtaccggctgtcgctgacccaggagaagctgcctgtctacatcagcctgggc
tgcagcgcgctgccgccgcggggccggcagccatggccaaggacatcctgggtgaagcagggctacactttgatgaactgaacaagctgagggtgttgga
cccagaggttacccagcagaccatagagctgaaggaagagtgcaaagactttgtggacaaaattggccagtttcagaaaatagttggtggtttaattgag
cttgttgatcaacttgcaaaagaagcagaaaatgaaaagatgaagagtcttgctgtgtcacccaggctggagtgcactggtgcaatctcggctcactgca
agctctgcctctcagattcaagcgattctcccacctcaccctcccgagtaggtgggactacaggccatcggtgctcggaacttgctcaaatctatagcaa
agcagagagaagctcaacagcagcaacttcaagccctaatagcagaaaagaaaatgcagctagaaaggtatcgggttgaatatgaagctttgtgtaaagt
agaagcagaacaaaatgaatttattgaccaatttatttttcagaaatgaactgaaaatttcgcttttatagtaggaaggcaaaacaaaaaaaagcctctc
aaaaccaaaaaaacctctgtagcattccagcggcttgaccaatgacctatgtcacaagaggtggcgtgtaaggaatgcagccccctgaagacagcactac
aagtctgggggagccagttttaacatcagtgcacagctgctgctggtggccctgcagtgtacgttctcacctcttatgcttagttggaactaagcagttt
gtaaactttcatccttttttttgtaaattcacaaagctttggaaggagaagcaataaatttttgttttcaaatgaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaa