Human ORFeome, Internal ID: 4028
BC number:  BC000345 UCSCBC000752 UCSCBC003655 UCSC
Entrez Gene ID:  6175
Length: 954Symbol:  RPLP0
Resource Plate: GDEh81060Resource Plate Position:  F02
Lentiviral Plate: CCSBBroad304_003D1Lentiviral Position:  D08
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGCCCAGGGAAGACAGG
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGTAGTCAAAGAGACCAAATCCCA
Description:  ribosomal protein, large, P0 CHROMOSOME: 12
Template Information: 
Vendor Plate:  20Vendor Position:  B02
Collection:  Vendor Name: Open Biosystems
Vector: pOTB7Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_8 lymph cell line
Clone ID:  3541947 Genbank Accession: KJ897493
GI:  38197122, 37588997, 33991021
MGC Coding Sequence: 
atgcccagggaagacagggcgacctggaagtccaactacttccttaagatcatccaactattggatgattatccgaaatgtttcattgtgggagcagaca
atgtgggctccaagcagatgcagcagatccgcatgtcccttcgtgggaaggctgtggtgctgatgggcaagaacaccatgatgcgcaaggccatccgagg
gcacctggaaaacaacccagctctggagaaactgctgcctcatatccgggggaatgtgggctttgtgttcaccaaggaggacctcactgagatcagggac
atgttgctggccaataaggtgccagctgctgcccgtgctggtgccattgccccatgtgaagtcactgtgccagcccagaacactggtctcgggcccgaga
agacctcctttttccaggctttaggtatcaccactaaaatctccaggggcaccattgaaatcctgagtgatgtgcagctgatcaagactggagacaaagt
gggagccagcgaagccacgctgctgaacatgctcaacatctcccccttctcctttgggctggtcatccagcaggtgttcgacaatggcagcatctacaac
cctgaagtgcttgatatcacagaggaaactctgcattctcgcttcctggagggtgtccgcaatgttgccagtgtctgtctgcagattggctacccaactg
ttgcatcagtaccccattctatcatcaacgggtacaaacgagtcctggccttgtctgtggagacggattacaccttcccacttgctgaaaaggtcaaggc
cttcttggctgatccatctgcctttgtggctgctgcccctgtggctgctgccaccacagctgctcctgctgctgctgcagccccagctaaggttgaagcc
aaggaagagtcggaggagtcggacgaggatatgggatttggtctctttgactaa
cDNA Sequence (including UTRs): 
cccgggaccgcgggatgggtgtcggcgtgaccaggcctgagctccctgtctctcctcagtgacatcgtctttaaaccctgcgtggcaatccctgacgcac
cgccgtgatgcccagggaagacagggcgacctggaagtccaactacttccttaagatcatccaactattggatgattatccgaaatgtttcattgtggga
gcagacaatgtgggctccaagcagatgcagcagatccgcatgtcccttcgtgggaaggctgtggtgctgatgggcaagaacaccatgatgcgcaaggcca
tccgagggcacctggaaaacaacccagctctggagaaactgctgcctcatatccgggggaatgtgggctttgtgttcaccaaggaggacctcactgagat
cagggacatgttgctggccaataaggtgccagctgctgcccgtgctggtgccattgccccatgtgaagtcactgtgccagcccagaacactggtctcggg
cccgagaagacctcctttttccaggctttaggtatcaccactaaaatctccaggggcaccattgaaatcctgagtgatgtgcagctgatcaagactggag
acaaagtgggagccagcgaagccacgctgctgaacatgctcaacatctcccccttctcctttgggctggtcatccagcaggtgttcgacaatggcagcat
ctacaaccctgaagtgcttgatatcacagaggaaactctgcattctcgcttcctggagggtgtccgcaatgttgccagtgtctgtctgcagattggctac
ccaactgttgcatcagtaccccattctatcatcaacgggtacaaacgagtcctggccttgtctgtggagacggattacaccttcccacttgctgaaaagg
tcaaggccttcttggctgatccatctgcctttgtggctgctgcccctgtggctgctgccaccacagctgctcctgctgctgctgcagccccagctaaggt
tgaagccaaggaagagtcggaggagtcggacgaggatatgggatttggtctctttgactaatcaccaaaaagcaaccaacttagccagttttatttgcaa
aacaaggaaataaaggcttacttctttaaaaaaaaaaaaaaaaaa