Human ORFeome, Internal ID: 3569
BC number:  BC000026 UCSCEntrez Gene ID:  10555
Length: 837Symbol:  AGPAT2
Resource Plate: GDEh81049Resource Plate Position:  D01
Lentiviral Plate: CCSBBroad304_010D1Lentiviral Position:  B04
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGAGCTGTGGCCGTGT
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGTACTGGGCCGGCTGCACG
Description:  1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) CHROMOSOME: 9
Template Information: 
Vendor Plate:  14Vendor Position:  H05
Collection:  Vendor Name: Open Biosystems
Vector: pOTB7Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_14 kidney tumor cell line
Clone ID:  3507150 Genbank Accession: KJ898240
GI:  34783031
MGC Coding Sequence: 
atggagctgtggccgtgtctggccgcggcgctgctgttgctgctgctgctggtgcagctgagccgcgcggccgagttctacgccaaggtcgccctgtact
gcgcgctgtgcttcacggtgtccgccgtggcctcgctcgtctgcctgctgcgccacggcggccggacggtggagaacatgagcatcatcggctggttcgt
gcgaagcttcaagtacttttacgggctccgcttcgaggtgcgggacccgcgcaggctgcaggaggcccgtccctgtgtcatcgtctccaaccaccagagc
atcctggacatgatgggcctcatggaggtccttccggagcgctgcgtgcagatcgccaagcgggagctgctcttcctggggcccgtgggcctcatcatgt
acctcgggggcgtcttcttcatcaaccggcagcgctctagcactgccatgacagtgatggccgacctgggcgagcgcatggtcagggagaacctcaaagt
gtggatctatcccgagggtactcgcaacgacaatggggacctgctgccttttaagaagggcgccttctacctggcagtccaggcacaggtgcccatcttc
cccgtggtgtactcttccttctcctccttctacaacaccaagaagaagttcttcacttcaggaacagtcacagtgcaggtgctggaagccatccccacca
gcggcctcactgcggcggacgtccctgcgctcgtggacacctgccaccgggccatgaggaccaccttcctccacatctccaagaccccccaggagaacgg
ggccactgcggggtctggcgtgcagccggcccagtag
cDNA Sequence (including UTRs): 
ggagcgggagcgagctggcggcgccgtcgggcgccgggccgggccatggagctgtggccgtgtctggccgcggcgctgctgttgctgctgctgctggtgc
agctgagccgcgcggccgagttctacgccaaggtcgccctgtactgcgcgctgtgcttcacggtgtccgccgtggcctcgctcgtctgcctgctgcgcca
cggcggccggacggtggagaacatgagcatcatcggctggttcgtgcgaagcttcaagtacttttacgggctccgcttcgaggtgcgggacccgcgcagg
ctgcaggaggcccgtccctgtgtcatcgtctccaaccaccagagcatcctggacatgatgggcctcatggaggtccttccggagcgctgcgtgcagatcg
ccaagcgggagctgctcttcctggggcccgtgggcctcatcatgtacctcgggggcgtcttcttcatcaaccggcagcgctctagcactgccatgacagt
gatggccgacctgggcgagcgcatggtcagggagaacctcaaagtgtggatctatcccgagggtactcgcaacgacaatggggacctgctgccttttaag
aagggcgccttctacctggcagtccaggcacaggtgcccatcttccccgtggtgtactcttccttctcctccttctacaacaccaagaagaagttcttca
cttcaggaacagtcacagtgcaggtgctggaagccatccccaccagcggcctcactgcggcggacgtccctgcgctcgtggacacctgccaccgggccat
gaggaccaccttcctccacatctccaagaccccccaggagaacggggccactgcggggtctggcgtgcagccggcccagtagcccagaccacggcagggc
atgacctggggagggcaggtggaagccgatggctggaggatgggcagaggggactcctcccggcttccaaataccactctgtccggctcccccagctctc
actcagcccgggaagcaggaagccccttctgtcactggtctcagacacaggcccctggtgtcccctgcagggggctcagctggaccctccccgggctcga
gggcagggactcgcgcccacggcacctctgggagctgggatgataaagatgaggcttgcggctgtggcccgctggtgggctgagccacaaggcccccgat
ggcccaggagcagatgggaggaccccgaggccagacgcacactgtccgagccctctgctcagccgcctgggacccaccagggtgcagctgggctccaggg
tccagcccacaagctgcatcagggtctctgggagaggaggggcctggagggccaggagtcccagactcacgcaccctgggccacagggagccgggaatcg
gggcctgctgctcctgctggcctggaagactctgtggggtcagcactgtactccgttgctgtttttttataaacacactcttggaagtggcaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaa