Human ORFeome, Internal ID: 3521
BC number:  BC000720 UCSCBC008890 UCSCEntrez Gene ID:  8409
Length: 474Symbol:  UXT
Resource Plate: GDEh81023Resource Plate Position:  E12
Lentiviral Plate: CCSBBroad304_132D1Lentiviral Position:  A11
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGCGACGCCCCCTAAG
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCAATGGTGAGGCTTCTCTGG
Description:  ubiquitously-expressed, prefoldin-like chaperone CHROMOSOME: X
Template Information: 
Vendor Plate:  14Vendor Position:  C05
Collection:  Vendor Name: Open Biosystems
Vector: pOTB7Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_21 placenta cell line
Clone ID:  3505415 Genbank Accession: KJ892529
GI:  14424496, 12653858
MGC Coding Sequence: 
atggcgacgccccctaagcggcgggcggtggaggccacgggggagaaagtgctgcgctacgagaccttcatcagtgacgtgctgcagcgggacttgcgaa
aggtgctggaccatcgagacaaggtatatgagcagctggccaaataccttcaactgagaaatgtcattgagcgactccaggaagctaagcactcggagtt
atatatgcaggtggatttgggctgtaacttcttcgttgacacagtggtcccagatacttcacgcatctatgtggccctgggatatggttttttcctggag
ttgacactggcagaagctctcaagttcattgatcgtaagagctctctcctcacagagctcagcaacagcctcaccaaggactccatgaatatcaaagccc
atatccacatgttgctagaggggcttagagaactacaaggcctgcagaatttcccagagaagcctcaccattga
cDNA Sequence (including UTRs): 
ggagcccatcatggcgacgccccctaagcggcgggcggtggaggccacgggggagaaagtgctgcgctacgagaccttcatcagtgacgtgctgcagcgg
gacttgcgaaaggtgctggaccatcgagacaaggtatatgagcagctggccaaataccttcaactgagaaatgtcattgagcgactccaggaagctaagc
actcggagttatatatgcaggtggatttgggctgtaacttcttcgttgacacagtggtcccagatacttcacgcatctatgtggccctgggatatggttt
tttcctggagttgacactggcagaagctctcaagttcattgatcgtaagagctctctcctcacagagctcagcaacagcctcaccaaggactccatgaat
atcaaagcccatatccacatgttgctagaggggcttagagaactacaaggcctgcagaatttcccagagaagcctcaccattgacttcttccccccatcc
tcagacattaaagagcctgaatgcctttgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa