Human ORFeome, Internal ID: 3395
BC number:  BC004355 UCSCEntrez Gene ID:  84265
Length: 657Symbol:  POLR3GL
Resource Plate: GDEh81031Resource Plate Position:  G07
Lentiviral Plate: CCSBBroad304_052D1Lentiviral Position:  H04
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGCCAGCCGGGGTGGGGG
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCAGTATATAGCCTCGTCCATATT
Description:  polymerase (RNA) III (DNA directed) polypeptide G (32kD)-like CHROMOSOME: 1
Template Information: 
Vendor Plate:  12Vendor Position:  G01
Collection:  Vendor Name: Open Biosystems
Vector: pOTB7Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_16 retinoblastoma cell line
Clone ID:  3357827 Genbank Accession: KJ894956
GI:  13279316
MGC Coding Sequence: 
atggccagccggggtgggggccggggtcgtggccggggccagttgaccttcaacgtggaggccgtgggcattgggaaaggggatgctttgcccccaccca
ccctgcagccttctccactcttccctcccttggagttccgcccagtacctttgccctcaggcgaggaaggggaatatgtcctggcactgaagcaagagct
acgaggagccatgaggcagctcccctacttcatccggccagctgtccccaagagagatgtggagcgttattcagacaaatatcagatgtcaggtccgatt
gacaatgccatcgattggaaccctgattggcggcgtctaccccgggagctaaagatccgagtgcggaagctacagaaggaacggattacaattctgctcc
ccaagaggccccctaagaccacagaagataaggaggaaacaatacagaaactagagaccctggagaagaaggaagaagaagtaacttcagaggaggatga
ggagaaagaagaagaagaagagaaggaagaggaggaagaagaagagtatgatgaagaagaacatgaagaggaaactgattacatcatgtcatattttgac
aatggagaggactttggtggtgacagtgatgacaatatggacgaggctatatactga
cDNA Sequence (including UTRs): 
cttgaggaagcccagtacatttcaagttggtcgcggcttgggctccgctttggggaggggcagcaggtttattcactggatctctgaatacccaggcccc
ctccaccatggccagccggggtgggggccggggtcgtggccggggccagttgaccttcaacgtggaggccgtgggcattgggaaaggggatgctttgccc
ccacccaccctgcagccttctccactcttccctcccttggagttccgcccagtacctttgccctcaggcgaggaaggggaatatgtcctggcactgaagc
aagagctacgaggagccatgaggcagctcccctacttcatccggccagctgtccccaagagagatgtggagcgttattcagacaaatatcagatgtcagg
tccgattgacaatgccatcgattggaaccctgattggcggcgtctaccccgggagctaaagatccgagtgcggaagctacagaaggaacggattacaatt
ctgctccccaagaggccccctaagaccacagaagataaggaggaaacaatacagaaactagagaccctggagaagaaggaagaagaagtaacttcagagg
aggatgaggagaaagaagaagaagaagagaaggaagaggaggaagaagaagagtatgatgaagaagaacatgaagaggaaactgattacatcatgtcata
ttttgacaatggagaggactttggtggtgacagtgatgacaatatggacgaggctatatactgaagaaggactctggaccctcgtgtctttctttaggat
acagagagtaactgtacctattatttgtttcttcagacaagcaaatcatttggtcagagttcatataatctgtctgttccctggagatgggaatagagga
tgatgacagtttattttctacacttcccctccttccacatttgtatcacctttgctatcttggggaaagtgcaaaggacaaacatctcaattgtatgaag
ggagaaaggagaattgaaagaagaactggggttgttagagctgagatgactgtacacatacccctgcccaatttatatagctctttgtggagataattag
gggtgggagcagtttgaaggagtaagcctggttttatacttttaaataaagtgtttttatctgtcaaaaaaaaaaaaaaaaaaaaaaaaaa