Human ORFeome, Internal ID: 3383
BC number:  BC001182 UCSCEntrez Gene ID:  65993
Length: 657Symbol:  MRPS34
Resource Plate: GDEh81031Resource Plate Position:  D07
Lentiviral Plate: CCSBBroad304_052D1Lentiviral Position:  H03
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGCGCGGAAGAAGGTG
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGTAGACGGGGGTGCCCTTG
Description:  mitochondrial ribosomal protein S34 CHROMOSOME: 16
Template Information: 
Vendor Plate:  12Vendor Position:  E09
Collection:  Vendor Name: Open Biosystems
Vector: pOTB7Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_16 retinoblastoma cell line
Clone ID:  3357266 Genbank Accession: KJ894611
GI:  12654686
MGC Coding Sequence: 
atggcgcggaagaaggtgcgtccgcggctgatcgcggagctggcccgccgcgtgcgcgccctgcgggagcaactgaacaggccgcgcgactcccagctct
acgcggtggactacgagaccttgacgcggccgttctctggacgccggctgccggtccgggcctgggccgacgtgcgccgcgagagccgcctcttgcagct
gctcggccgcctcccgctcttcggcctgggccgcctggtcacgcgcaagtcctggctgtggcagcacgacgagccgtgctactggcgcctcacgcgggtg
cggcccgactacacggcgcagaacttggaccacgggaaggcctggggcatcctgaccttcaaagggaagactgagagcgaggcgcgggagatcgaacacg
tcatgtaccatgactggcggctggtgcccaagcacgaggaggaggccttcaccgcgttcacgccggcgccggaagacagcctggcctccgtgccgtaccc
gcctctcctccgggccatgattatcgcagaacgacagaaaaatggagacacaagcaccgaggagcccatgctgaatgtgcagaggatacgcatggaaccc
tgggattaccctgcaaaacaggaagacaaaggaagggccaagggcacccccgtctag
cDNA Sequence (including UTRs): 
gctgaggacgcggacccgccatggcgcggaagaaggtgcgtccgcggctgatcgcggagctggcccgccgcgtgcgcgccctgcgggagcaactgaacag
gccgcgcgactcccagctctacgcggtggactacgagaccttgacgcggccgttctctggacgccggctgccggtccgggcctgggccgacgtgcgccgc
gagagccgcctcttgcagctgctcggccgcctcccgctcttcggcctgggccgcctggtcacgcgcaagtcctggctgtggcagcacgacgagccgtgct
actggcgcctcacgcgggtgcggcccgactacacggcgcagaacttggaccacgggaaggcctggggcatcctgaccttcaaagggaagactgagagcga
ggcgcgggagatcgaacacgtcatgtaccatgactggcggctggtgcccaagcacgaggaggaggccttcaccgcgttcacgccggcgccggaagacagc
ctggcctccgtgccgtacccgcctctcctccgggccatgattatcgcagaacgacagaaaaatggagacacaagcaccgaggagcccatgctgaatgtgc
agaggatacgcatggaaccctgggattaccctgcaaaacaggaagacaaaggaagggccaagggcacccccgtctagaatgccagaaccagcgggtggcc
ttaggggctgtgaggcagtggggaccttattgatgaaagaaaccgtctttgcgttacacccgagtctgcctctcggagcagggagctcaccttccgcgac
gtgttctgagggtctgcatcttaggggggagggctggggcaaatcgccacctgtgcctttcctctggccctgctgcccccacacccaactccgagggccc
acgctggggaaagcgggaagcgctcgctccctttcccccattagtgctctctctgcctggatcccggcagaagctatgaaagggaataaagagaaaagaa
gtaaaaaaaaaaaaaaaaaa