Human ORFeome, Internal ID: 3227
BC number:  BC000668 UCSCBC007083 UCSCEntrez Gene ID:  51293
Length: 849Symbol:  CD320
Resource Plate: GDEh81091Resource Plate Position:  H08
Lentiviral Plate: CCSBBroad304_119D1Lentiviral Position:  G08
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGAGCGGCGGTTGGATGG
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCAGGGCAGCGAGGTCTTCTGT
Description:  CD320 molecule CHROMOSOME: 19
Template Information: 
Vendor Plate:  45Vendor Position:  C09
Collection:  Vendor Name: Open Biosystems
Vector: pDNR-LIBCatalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_56 brain cell line
Clone ID:  4076237 Genbank Accession: KJ893875
GI:  34784777, 13937942
MGC Coding Sequence: 
atgagcggcggttggatggcgcaggttggagcgtggcgaacaggggctctgggcctggcgctgctgctgctgctcggcctcggactaggcctggaggccg
ccgcgagcccgctttccaccccgacctctgcccaggccgcaggccccagctcaggctcgtgcccacccaccaagttccagtgccgcaccagtggcttatg
cgtgcccctcacctggcgctgcgacagggacttggactgcagcgatggcagcgatgaggaggagtgcaggattgagccatgtacccagaaagggcaatgc
ccaccgccccctggcctcccctgcccctgcaccggcgtcagtgactgctctgggggaactgacaagaaactgcgcaactgcagccgcctggcctgcctag
caggcgagctccgttgcacgctgagcgatgactgcattccactcacgtggcgctgcgacggccacccagactgtcccgactccagcgacgagctcggctg
tggaaccaatgagatcctcccggaaggggatgccacaaccatggggccccctgtgaccctggagagtgtcacctctctcaggaatgccacaaccatgggg
ccccctgtgaccctggagagtgtcccctctgtcgggaatgccacatcctcctctgccggagaccagtctggaagcccaactgcctatggggttattgcag
ctgctgcggtgctcagtgcaagcctggtcaccgccaccctcctccttttgtcctggctccgagcccaggagcgcctccgcccactggggttactggtggc
catgaaggagtccctgctgctgtcagaacagaagacctcgctgccctga
cDNA Sequence (including UTRs): 
ggcgccgctgtggggacagcatgagcggcggttggatggcgcaggttggagcgtggcgaacaggggctctgggcctggcgctgctgctgctgctcggcct
cggactaggcctggaggccgccgcgagcccgctttccaccccgacctctgcccaggccgcaggccccagctcaggctcgtgcccacccaccaagttccag
tgccgcaccagtggcttatgcgtgcccctcacctggcgctgcgacagggacttggactgcagcgatggcagcgatgaggaggagtgcaggattgagccat
gtacccagaaagggcaatgcccaccgccccctggcctcccctgcccctgcaccggcgtcagtgactgctctgggggaactgacaagaaactgcgcaactg
cagccgcctggcctgcctagcaggcgagctccgttgcacgctgagcgatgactgcattccactcacgtggcgctgcgacggccacccagactgtcccgac
tccagcgacgagctcggctgtggaaccaatgagatcctcccggaaggggatgccacaaccatggggccccctgtgaccctggagagtgtcacctctctca
ggaatgccacaaccatggggccccctgtgaccctggagagtgtcccctctgtcgggaatgccacatcctcctctgccggagaccagtctggaagcccaac
tgcctatggggttattgcagctgctgcggtgctcagtgcaagcctggtcaccgccaccctcctccttttgtcctggctccgagcccaggagcgcctccgc
ccactggggttactggtggccatgaaggagtccctgctgctgtcagaacagaagacctcgctgccctgaggacaagcacttgccaccaccgtcactcagc
cctgggcgtagccggacaggaggagagcagtgatgcggatgggtacccgggcacaccagccctcagagacctgagctcttctggccacgtggaacctcga
acccgagctcctgcagaagtggccctggagattgagggtccctggacactccctatggagatccggggagctaggatggggaacctgccacagccagaac
tgaggggctggccccaggcagctcccagggggtagaacggccctgtgcttaagacactcctgctgccccgtctgagggtggcgattaaagttgcttcaca
tccttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa