Human ORFeome, Internal ID: 3201
BC number:  BC000596 UCSCEntrez Gene ID:  118433
Length: 366Symbol:  RPL23AP7
Resource Plate: GDEh81008Resource Plate Position:  C02
Lentiviral Plate: CCSBBroad304_050D1Lentiviral Position:  H02
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGTCACTCACCTTCAGGCG
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGTAGCCAGCTGGACTCAGTT
Description:  ribosomal protein L23a pseudogene 7 CHROMOSOME: 2
Template Information: 
Vendor Plate:  10Vendor Position:  A06
Collection:  Vendor Name: Open Biosystems
Vector: pOTB7Catalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_20 melanoma cell line
Clone ID:  3346366 Genbank Accession: KJ901145
GI:  12653636
MGC Coding Sequence: 
atgtcactcaccttcaggcggcccaagacactgcgactccggaggcagcccagatatcctcagaagagcacccccaggagaaacaagcttggccactatg
ctatcatcaagtttccgctgaccactgagtcggccgtgaagaagatagaagaaaacaacacgcttgtgttcactgtggatgttaaagccaacaagcacca
gatcagacaggctgtgaagaagctctatgacagtgatgtggccaaggtcaccaccctgatttgtcctgataaagagaagaaggcatatgttcgacttgct
cctgattatgatgctttcaatgttgtaacaaaattgggatcacctaaactgagtccagctggctaa
cDNA Sequence (including UTRs): 
agggtggtactgaggcttcagcgggtgccgcccgcctagagggagtggagcgagagcctacgactagatttgcatctttacgtcctgcgcggaggctgct
acacacatgcagaagtcatgctggtggcctggacattgaagggagagaagtggatttgggagacatttaggagatggcaccgaaagcgaaggaagctcct
gctcctcctaaagccgaagccaaagcaaaggctttaaaggccaagaaggcagtgttgaaaggtgtccgcagccacacgcaaaaaagaggatccgcatgtc
actcaccttcaggcggcccaagacactgcgactccggaggcagcccagatatcctcagaagagcacccccaggagaaacaagcttggccactatgctatc
atcaagtttccgctgaccactgagtcggccgtgaagaagatagaagaaaacaacacgcttgtgttcactgtggatgttaaagccaacaagcaccagatca
gacaggctgtgaagaagctctatgacagtgatgtggccaaggtcaccaccctgatttgtcctgataaagagaagaaggcatatgttcgacttgctcctga
ttatgatgctttcaatgttgtaacaaaattgggatcacctaaactgagtccagctggctaactctaaatatatgtgtatcttttcagcataaaaaataat
gtttttcataagaatgacaacttaattagaatcaaatctataagctttaagattttacgtttctagtaagtataatattagcttatttgactagaactca
agcagaataggaatttatgcttgttttatattcaataatgataattttgaagatatagttgttttattacaccaaaaatactatattaatcttatttaac
taagttttatccaaatcatgttaacttaagaaacatttgatcagttcctataaaaaaaaaaaaaaaaaa