Human ORFeome, Internal ID: 2279
BC number:  BC029588 UCSCEntrez Gene ID:  150142
Length: 414Symbol:  C21orf121
Resource Plate: GDEh81022Resource Plate Position:  B01
Lentiviral Plate: CCSBBroad304_022D1Lentiviral Position:  C02
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGAAAGATAAAATGTGGTGTGAG
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGTAAGGCCGTGGAGAGAGGGT
Description:  ZNF295 antisense RNA 1 (non-protein coding) CHROMOSOME: 21
Template Information: 
Vendor Plate:  34Vendor Position:  H08
Collection:  Vendor Name: Open Biosystems
Vector: pBluescriptRCatalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_97 testis
Clone ID:  5271985 Genbank Accession: KJ901166
GI:  20810334
MGC Coding Sequence: 
atgaaagataaaatgtggtgtgaggacacggcccagccccaccgtcgtcttccagccccaccatcgtcttccagccccaccgtcgtcttccagccccacc
gtcgtcttctagccccaccatcgtcgtcttggactctctgggtggcaccacgctgtgggtgctgctctcctctgtgtcccaaacgagtttgtgcctcact
ttgtcgggttttggctgtgacttggagcctcaccaagctcccttttcctctgtctcccattctcctctccaggccagggtggcttccccagccctcctcc
ccgggtcctgcctgtgccgagccttcctcccaggagggaggtgatactgacttgagatcttatgggtgttttgtttgtggctgggcctggccgaccctct
ctccacggccttag
cDNA Sequence (including UTRs): 
gctctctccggtccccagtgcatgggctggagtgtggcccctggcagagccctggaggccggctctgcttcctgcccccttccagcctggagcagcccga
gggcgcagcattcctggggcaggcctgagccctgtggtgggctgagttgagtccccagaaaggatctatgaaagataaaatgtggtgtgaggacacggcc
cagccccaccgtcgtcttccagccccaccatcgtcttccagccccaccgtcgtcttccagccccaccgtcgtcttctagccccaccatcgtcgtcttgga
ctctctgggtggcaccacgctgtgggtgctgctctcctctgtgtcccaaacgagtttgtgcctcactttgtcgggttttggctgtgacttggagcctcac
caagctcccttttcctctgtctcccattctcctctccaggccagggtggcttccccagccctcctccccgggtcctgcctgtgccgagccttcctcccag
gagggaggtgatactgacttgagatcttatgggtgttttgtttgtggctgggcctggccgaccctctctccacggccttagatcacactctggatggata
ggacagtcgtcctcaatactgagcctctttggagcatacccactgatggtggttcacaagctacccacgcccacaggctgacccagatctccgtgaaatt
aaaaaatactgtgaaaggaaaaagagccaatgtcatgtggataatgaagtgtcagccactgaaaaatctcaaaataacaaaaaaaaaaaaaaaa