Human ORFeome, Internal ID: 2235
BC number:  BC029606 UCSCEntrez Gene ID:  200931
Length: 624Symbol:  OSTalpha
Resource Plate: GDEh81030Resource Plate Position:  C06
Lentiviral Plate: CCSBBroad304_044D1Lentiviral Position:  E10
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGTGGAAGGCTTTGGGGGGA
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGTAGGCTTTGAGGTTCAAGTC
Description:  organic solute transporter alpha CHROMOSOME: 3
Template Information: 
Vendor Plate:  34Vendor Position:  D03
Collection:  Vendor Name: Open Biosystems
Vector: pBluescriptRCatalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_97 testis
Clone ID:  5297443 Genbank Accession: KJ903990
GI:  20810345
MGC Coding Sequence: 
atggtggaaggctttggggggaaggaggcagtgctgaggacgctgagggacaccccgatgatggtccacacaggcccctgctgctgctgctgcccctgct
gtccacggctgctgctcaccaggaagaagcttcagctgctgatgttgggccctttccaatacgccttcttgaagataacgctgaccctggtgggcctgtt
tctcatccccgacggcatctatgacccagcagacatttctgaggggagcacagctctatggatcaacactttcctcggcgtgtccacactgctggctctc
tggaccctgggcatcatttcccgtcaagccaggctacacctgggtgagcagaacatgggagccaaatttgctctgttccaggttctcctcatcctgactg
ccctacagccctccatcttctcagtcttggccaacggtgggcagattgcttgttcgcctccctattcctctaaaaccaggtctcaagtgatgaattgcca
cctcctcatactggagacttttctaatgactgtgctgacacgaatgtactaccgaaggaaagaccacaaggttgggtatgaaactttctcttctccagac
ctggacttgaacctcaaagcctaa
cDNA Sequence (including UTRs): 
gagtctgaaattccccttctcccagtcctgtgggccgtctcctctccctcgcccctcttgggtcacacacccagaacgcccagccctagctctgctcctc
agtaagccccacctctccctgctgtctttctctctggcagcagacctcgtaggccctcttctctccccaccccaggttttatgccgtgtgcttttacctg
ctgatgctggtcatggtggaaggctttggggggaaggaggcagtgctgaggacgctgagggacaccccgatgatggtccacacaggcccctgctgctgct
gctgcccctgctgtccacggctgctgctcaccaggaagaagcttcagctgctgatgttgggccctttccaatacgccttcttgaagataacgctgaccct
ggtgggcctgtttctcatccccgacggcatctatgacccagcagacatttctgaggggagcacagctctatggatcaacactttcctcggcgtgtccaca
ctgctggctctctggaccctgggcatcatttcccgtcaagccaggctacacctgggtgagcagaacatgggagccaaatttgctctgttccaggttctcc
tcatcctgactgccctacagccctccatcttctcagtcttggccaacggtgggcagattgcttgttcgcctccctattcctctaaaaccaggtctcaagt
gatgaattgccacctcctcatactggagacttttctaatgactgtgctgacacgaatgtactaccgaaggaaagaccacaaggttgggtatgaaactttc
tcttctccagacctggacttgaacctcaaagcctaaggtggatggcttggacaatgaaaggatgctgtactcattagaatacaagattcctttactgtcc
ctcaaccttgaccaaatgggaagcattcccccttgtcaacacaagctggcagatacatttgactctacagatgaaggtgaacaatgttaggataaaattg
ctttggatcttgcctggaaggtgttttaagttttgtaataaacaagatgatgtctgaaaatgtgaaaaaaaaaaaaaaaa