Human ORFeome, Internal ID: 2124
BC number:  BC029515 UCSCEntrez Gene ID:  1068
Length: 519Symbol:  CETN1
Resource Plate: GDEh81025Resource Plate Position:  D09
Lentiviral Plate: CCSBBroad304_104D1Lentiviral Position:  H04
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGCTTCCGGCTTCAAG
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCAGTAAAGGCTGGTCTTC
Description:  centrin, EF-hand protein, 1 CHROMOSOME: 18
Template Information: 
Vendor Plate:  33Vendor Position:  B02
Collection:  Vendor Name: Open Biosystems
Vector: pBluescriptRCatalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_97 testis
Clone ID:  5297994 Genbank Accession: KJ890899
GI:  20809601
MGC Coding Sequence: 
atggcttccggcttcaagaagcccagcgctgcctccaccggccaaaagagaaaggtggcacctaagcccgagctcactgaggatcagaagcaagaagttc
gggaagcatttgacctcttcgacgtggacggaagtgggaccatcgacgcgaaggagctgaaggtggccatgagagcgctgggcttcgaacccaggaagga
agagatgaagaaaatgatctccgaggtggacagggaaggcacggggaagatcagcttcaatgacttcctggccgtgatgacgcagaagatgtccgagaag
gacaccaaagaagaaatcctgaaggccttcaggctctttgatgacgatgagaccgggaagatctcgttcaaaaacctgaagcgtgtggccaacgagctgg
gggagaacctcacggatgaggagctgcaggagatgatcgacgaagctgatcgggatggggacggcgaagtgaacgaggaggagttccttcggatcatgaa
gaagaccagcctttactga
cDNA Sequence (including UTRs): 
gaatgagagcgcggggcggtgccgttgggaccacggcggccagagcggcaggatggcttccggcttcaagaagcccagcgctgcctccaccggccaaaag
agaaaggtggcacctaagcccgagctcactgaggatcagaagcaagaagttcgggaagcatttgacctcttcgacgtggacggaagtgggaccatcgacg
cgaaggagctgaaggtggccatgagagcgctgggcttcgaacccaggaaggaagagatgaagaaaatgatctccgaggtggacagggaaggcacggggaa
gatcagcttcaatgacttcctggccgtgatgacgcagaagatgtccgagaaggacaccaaagaagaaatcctgaaggccttcaggctctttgatgacgat
gagaccgggaagatctcgttcaaaaacctgaagcgtgtggccaacgagctgggggagaacctcacggatgaggagctgcaggagatgatcgacgaagctg
atcgggatggggacggcgaagtgaacgaggaggagttccttcggatcatgaagaagaccagcctttactgaagtcggttcagaagctaaagtgactctct
gggttgcctgcttccattttgtgaaaccttagaggacagcggctgcctgtcccttcttcaccccctcacccccataatttgtctagatctatttccatat
ctctagttcaataatagaatttgaaagatgcttgtaatgtgagttttgggttttaattctcaagagtcaacctggagcacatgaggttaaacaaagggcc
ctgaagtttgagtgcgccctccatttgccctgtgctgaacttgcagagacatctgttgatctggaggcaggacagcttctgggacacacaaaaatgtggt
tccctttgtcacttctttggtggtcttaaattatcttgcttcatatatcattccttaaattccagtcattgttccagcataatgagatggaatctgccag
tagatttgcctagcctgtccacttagctgaataccagtttgaaggaaaacagggtggccacttacaaacttacggagctcaggacagataatcttataaa
gaatagacttgcttgggtggtagtacgttgtgcaattttgactattcactggctttatacctgcaaatgattcttcgttcatgtgtaaattgtccaccat
gggtttatctagggctagtatgtatacctgggctacagaataaaaataaaatctaatactggcccaagcaaaaaaaaaaaaaaaa