Human ORFeome, Internal ID: 1870
BC number:  BC026107 UCSCEntrez Gene ID:  11103
Length: 1146Symbol:  KRR1
Resource Plate: GDEh81073Resource Plate Position:  D08
Lentiviral Plate: CCSBBroad304_136D1Lentiviral Position:  A06
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGCGTCTCCCTCGCTG
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGTACTTTTTTTTCTTCTTTTTCTTTTCATCTG
Description:  KRR1, small subunit (SSU) processome component, homolog (yeast) CHROMOSOME: 12
Template Information: 
Vendor Plate:  30Vendor Position:  B10
Collection:  Vendor Name: Open Biosystems
Vector: pBluescriptRCatalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_97 testis
Clone ID:  4827704 Genbank Accession: KJ898358
GI:  34783224
MGC Coding Sequence: 
atggcgtctccctcgctggagcggccagaaaaaggcgctggaaaaagtgaatttcgtaaccagaagccgaagccggagaaccaagatgaatcagaactcc
ttacggttcctgatggttggaaggagccagctttttccaaagaggacaatcccagaggacttttggaggagagcagtttcgcaactttgttcccaaaata
cagggaagcttacttgaaagagtgttggccattggtgcagaaagccttaaatgaacatcatgttaatgcaaccctggacctgatcgaaggcagcatgact
gtttgtactacaaagaagacttttgatccatatatcatcattagggccagagatctgataaaactgttagcaaggagtgtttcatttgaacaggcagtac
gaattcttcaggatgatgttgcatgtgacatcattaaaataggttctttagtaaggaataaagagagatttgtaaaacgaagacaacggcttattggtcc
caaaggatctacattgaaggcattggaactcttaactaattgttacattatggttcagggaaacacagtttcagccattggaccttttagtggcttaaaa
gaggttagaaaagtagcccttgatactatgaagaatattcatccaatttataacattaaaagcttaatgattaagagagagttggcaaaagattctgaat
tacgatcacaaagttgggagagatttttgccacagttcaaacacaaaaatgtgaataaacgcaaggaaccaaagaaaaaaactgttaagaaagaatatac
gccattcccaccaccacaaccagaaagtcagatcgataaagaattggctagtggtgaatactttttgaaggcaaatcagaagaagcggcagaaaatggaa
gcaataaaggctaaacaagcagaagccatcagtaagagacaagaggaaagaaacaaagcatttattccacctaaggaaaaaccaattgtgaaacctaagg
aagcttctactgaaactaaaattgatgtggccagcatcaaggaaaaggttaagaaagcaaagaataagaaactgggagctcttacagctgaagaaattgc
acttaagatggaggcagatgaaaagaaaaagaagaaaaaaaagtaa
cDNA Sequence (including UTRs): 
ggagtcaccggaagcagcttgcaaatggcgtctccctcgctggagcggccagaaaaaggcgctggaaaaagtgaatttcgtaaccagaagccgaagccgg
agaaccaagatgaatcagaactccttacggttcctgatggttggaaggagccagctttttccaaagaggacaatcccagaggacttttggaggagagcag
tttcgcaactttgttcccaaaatacagggaagcttacttgaaagagtgttggccattggtgcagaaagccttaaatgaacatcatgttaatgcaaccctg
gacctgatcgaaggcagcatgactgtttgtactacaaagaagacttttgatccatatatcatcattagggccagagatctgataaaactgttagcaagga
gtgtttcatttgaacaggcagtacgaattcttcaggatgatgttgcatgtgacatcattaaaataggttctttagtaaggaataaagagagatttgtaaa
acgaagacaacggcttattggtcccaaaggatctacattgaaggcattggaactcttaactaattgttacattatggttcagggaaacacagtttcagcc
attggaccttttagtggcttaaaagaggttagaaaagtagcccttgatactatgaagaatattcatccaatttataacattaaaagcttaatgattaaga
gagagttggcaaaagattctgaattacgatcacaaagttgggagagatttttgccacagttcaaacacaaaaatgtgaataaacgcaaggaaccaaagaa
aaaaactgttaagaaagaatatacgccattcccaccaccacaaccagaaagtcagatcgataaagaattggctagtggtgaatactttttgaaggcaaat
cagaagaagcggcagaaaatggaagcaataaaggctaaacaagcagaagccatcagtaagagacaagaggaaagaaacaaagcatttattccacctaagg
aaaaaccaattgtgaaacctaaggaagcttctactgaaactaaaattgatgtggccagcatcaaggaaaaggttaagaaagcaaagaataagaaactggg
agctcttacagctgaagaaattgcacttaagatggaggcagatgaaaagaaaaagaagaaaaaaaagtaacatacccaaaactccttgactagaactatc
tccttttgtaaaggattttgagatatcaggcattagttgccttatttgtgagaaattttctgagggctttttttttttttggtggtggtggttgttcata
gaagagtgttctttataaattatattattattgtattttttgaaaaatttatactagaaagtggtatatatatctttgtatacattacgaccattgtgat
tatccattaaatccagtgtctgatgctattggttagtaatgatgtcccagcatttgatgttccctctctaatgataacaagtaaatatttaggtttatcc
cttttgaaaaaaaaaaaaaaaa