Human ORFeome, Internal ID: 1868
BC number:  BC022064 UCSCEntrez Gene ID:  89885
Length: 552Symbol:  FATE1
Resource Plate: GDEh81027Resource Plate Position:  A07
Lentiviral Plate: CCSBBroad304_104D1Lentiviral Position:  H09
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGCAGGAGGCCCTCCCAA
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCACTGGTTCATCCACAGCCAC
Description:  fetal and adult testis expressed 1 CHROMOSOME: X
Template Information: 
Vendor Plate:  30Vendor Position:  B08
Collection:  Vendor Name: Open Biosystems
Vector: pBluescriptRCatalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_97 testis
Clone ID:  4826440 Genbank Accession: KJ895103
GI:  34190851
MGC Coding Sequence: 
atggcaggaggccctcccaacaccaaggcggagatggaaatgtccctggcagaagaactgaatcatggacgccaaggggaaaaccaagagcacctggtga
tagcagaaatgatggagcttggatctcggtcccggggtgcctcccagaagaagcagaagttggaacaaaaagctgctggctctgcttcagccaaacgagt
ttggaatatgactgccacccgacccaagaaaatggggtcccagctgccaaagcccagaatgctgagagaatcaggccatggggatgcccatctccaggag
tacgctggcaatttccaaggcatacgtttccattatgatcgcaacccagggacagatgcagtggcgcagactagcctggaagagttcaatgtactggaga
tggaagtcatgagaagacagctgtatgcagtcaaccggcgtctgcgcgccctggaggaacagggcgccacctggcgccacagggagaccctgatcatcgc
cgtgctggtgtcggccagcattgccaacctgtggctgtggatgaaccagtga
cDNA Sequence (including UTRs): 
agaggtgattttctgagtgtgactcctctgttcctggcaccctgtgcatccttagccatagcttacaagagaacagctggttgtgatggcaggaggccct
cccaacaccaaggcggagatggaaatgtccctggcagaagaactgaatcatggacgccaaggggaaaaccaagagcacctggtgatagcagaaatgatgg
agcttggatctcggtcccggggtgcctcccagaagaagcagaagttggaacaaaaagctgctggctctgcttcagccaaacgagtttggaatatgactgc
cacccgacccaagaaaatggggtcccagctgccaaagcccagaatgctgagagaatcaggccatggggatgcccatctccaggagtacgctggcaatttc
caaggcatacgtttccattatgatcgcaacccagggacagatgcagtggcgcagactagcctggaagagttcaatgtactggagatggaagtcatgagaa
gacagctgtatgcagtcaaccggcgtctgcgcgccctggaggaacagggcgccacctggcgccacagggagaccctgatcatcgccgtgctggtgtcggc
cagcattgccaacctgtggctgtggatgaaccagtgatcgccccagcgcggcctccgtattggagccatccctgcttccccttctttctttcctctttcc
ccaggccgccactgcccttgcccctttcatctcccagcagccctcaggagcgtcaggatcattttcaactctggttaggcctcctacctggggaggccag
gtcactgcactgggaggtcctggctgctgcgaagctggaggaggactgcgtgggctgagatgccaccctttgaagggtgaacagcatggcggcatctggg
ccccccagtaacacctagtggcaaccttgccttcctgacctcagcggcccttctgttccatcctctgtgggcaggggtgtggctttgttttcctccctcg
tttgcttccacctcgtgcacagcgctctgcacagacaacacgctcaataaaagttcagccatagcagcaaaaaaaaaaaaaaaa