Human ORFeome, Internal ID: 1604
BC number:  BC027599 UCSCEntrez Gene ID:  3568
Length: 1008Symbol:  IL5RA
Resource Plate: GDEh81120Resource Plate Position:  E05
Lentiviral Plate: CCSBBroad304_012D1Lentiviral Position:  B02
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGATCATCGTGGCGCATGTA
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGTATCTTGAGAACCCCACATAAATA
Description:  interleukin 5 receptor, alpha CHROMOSOME: 3
Template Information: 
Vendor Plate:  27Vendor Position:  G11
Collection:  Vendor Name: Open Biosystems
Vector: pBluescriptRCatalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_97 testis
Clone ID:  4829051 Genbank Accession: KJ897047
GI:  34190377
MGC Coding Sequence: 
atgatcatcgtggcgcatgtattactcatccttttgggggccactgagatactgcaagctgacttacttcctgatgaaaagatttcacttctcccgcctg
tcaatttcaccattaaagttactggtttggctcaagttcttttacaatggaaaccaaatcctgatcaagagcaaaggaatgttaatctagaatatcaagt
gaaaataaacgctccaaaagaagatgactatgaaaccagaatcactgaaagcaaatgtgtaaccatcctccacaagggcttttcagcaagtgtgcggacc
atcctgcagaacgaccactcactactggccagcagctgggcttctgctgaacttcatgccccaccagggtctcctggaacctcaattgtgaatttaactt
gcaccacaaacactacagaagacaattattcacgtttaaggtcataccaagtttcccttcactgcacctggcttgttggcacagatgcccctgaggacac
gcagtattttctctactataggtatggctcttggactgaagaatgccaagaatacagcaaagacacactggggagaaatatcgcatgctggtttcccagg
acttttatcctcagcaaagggcgtgactggcttgcggtgcttgttgacggctccagcaagcactctgctatcaggccctttgatcagctgtttgcccttc
acgccattgatcaaataaatcctccactgaatgtcacagcagagattgaaggaactcgtctctctatccaatgggagaaaccagtgtctgcttttccaat
ccattgctttgattatgaagtaaaaatacacaatacaaggaatggatatttgcagatagaaaaattgatgaccaatgcattcatctcaataattgatgat
ctttctaagtacgatgttcaagtgagagcagcagtgagctccatgtgcagagaggcagggctctggagtgagtggagccaacctatttatgtggggttct
caagataa
cDNA Sequence (including UTRs): 
acggttgctctgtacaaatcctcctccatatttgcttagagaaaacgtgttgccatcccatcatgaaggaagctgcctgagagtttttaaccattacagc
cgtgatgatgaaagagtgaagaaccgcctctaagttaaaaagtgcacccagagataaggttcgttctcaatgctctgccgctgcttctcatcgcatggcc
accgcatttctcaggccaggcacattgagcattggtcctgtgcctgacgctatgctagatgctggggttgcagccacgagcatagacacgacagacacgg
tcctcgccatcttctgttgagtactggtcggaacaagaggatcgtctgtagacaggatatgatcatcgtggcgcatgtattactcatccttttgggggcc
actgagatactgcaagctgacttacttcctgatgaaaagatttcacttctcccgcctgtcaatttcaccattaaagttactggtttggctcaagttcttt
tacaatggaaaccaaatcctgatcaagagcaaaggaatgttaatctagaatatcaagtgaaaataaacgctccaaaagaagatgactatgaaaccagaat
cactgaaagcaaatgtgtaaccatcctccacaagggcttttcagcaagtgtgcggaccatcctgcagaacgaccactcactactggccagcagctgggct
tctgctgaacttcatgccccaccagggtctcctggaacctcaattgtgaatttaacttgcaccacaaacactacagaagacaattattcacgtttaaggt
cataccaagtttcccttcactgcacctggcttgttggcacagatgcccctgaggacacgcagtattttctctactataggtatggctcttggactgaaga
atgccaagaatacagcaaagacacactggggagaaatatcgcatgctggtttcccaggacttttatcctcagcaaagggcgtgactggcttgcggtgctt
gttgacggctccagcaagcactctgctatcaggccctttgatcagctgtttgcccttcacgccattgatcaaataaatcctccactgaatgtcacagcag
agattgaaggaactcgtctctctatccaatgggagaaaccagtgtctgcttttccaatccattgctttgattatgaagtaaaaatacacaatacaaggaa
tggatatttgcagatagaaaaattgatgaccaatgcattcatctcaataattgatgatctttctaagtacgatgttcaagtgagagcagcagtgagctcc
atgtgcagagaggcagggctctggagtgagtggagccaacctatttatgtggggttctcaagataaaggagataacatccagctttcctgccccacaccg
tatctgaaataaaaacaacagcaggaaaaaaaaaaaaaaa