Human ORFeome, Internal ID: 1549
BC number:  BC026092 UCSCEntrez Gene ID:  7718
Length: 1458Symbol:  ZNF165
Resource Plate: GDEh81088Resource Plate Position:  F09
Lentiviral Plate: CCSBBroad304_144D1Lentiviral Position:  A06
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGCTACAGAACCAAAGAAAG
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGTACATTAATAGGTTTTCCCTCATGTG
Description:  zinc finger protein 165 CHROMOSOME: 6
Template Information: 
Vendor Plate:  27Vendor Position:  A11
Collection:  Vendor Name: Open Biosystems
Vector: pBluescriptRCatalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_97 testis
Clone ID:  4837021 Genbank Accession: KJ897774
GI:  19913540
MGC Coding Sequence: 
atggctacagaaccaaagaaagctgcagcccagaactctccagaggatgaaggacttctgatagtgaagatagaagaggaagaatttatccatgggcagg
acacttgcttacagagaagtgaactccttaagcaggagctctgcaggcagctttttaggcagttctgctaccaggattctcctggacctcgcgaggcact
gagccgcctccgggagctctgctgtcagtggctgaagccagagatccataccaaggaacagattctggaactgctggtgctagagcagttcctgaccatc
ctgccaggagatttgcaggcctgggtacatgaacattacccagagagtggagaggaggcagtgaccatactagaagatttggagagaggcactgatgaag
cagtactccaggttcaagcccatgaacatggacaagaaatattccagaaaaaagtgtcacctcctggaccagcacttaatgtcaagttacagccagtgga
gaccaaggcccattttgattcatcagaaccccagctcctatgggactgtgataatgagagtgaaaacagtagatccatgccaaagctggaaatttttgaa
aaaattgaatcacagagaattatatctggaagaatctcaggatacatatcagaagcgtctggtgagtctcaagacatctgtaagtctgcaggcagggtaa
agagacaatgggaaaaagaatcaggggagtctcagagactctcgtctgcccaggatgaaggttttggtaaaatcctcacccacaaaaatacagtcagagg
tgaaataataagccacgatggatgtgagaggagattaaatctgaactcaaatgaattcacacaccagaaatcttgtaaacatggtacctgtgaccagagc
ttcaaatggaactcagattttattaaccatcaaataatttatgctggagaaaaaaatcaccaatatggaaaatctttcaagagcccaaaacttgctaaac
atgcagcagttttcagtggagataaaactcatcagtgtaatgaatgtgggaaagctttcaggcacagctcaaaacttgctaggcatcagagaatccacac
tggagagagatgctatgaatgtaatgaatgtgggaaaagctttgcagagagctcagatcttactagacatcggcgaattcacactggggaaagacccttt
ggttgcaaagaatgtgggagagcattcaacctgaactcacatcttatcaggcatcagagaattcacaccagagagaaaccctacgagtgtagtgaatgtg
ggaaaaccttccgagtgagctcacatcttattcgacactttagaattcacactggagaaaaaccctatgaatgcagtgagtgtggaagagccttcagtca
gagctcaaaccttagtcaacaccagagaattcacatgagggaaaacctattaatgtaa
cDNA Sequence (including UTRs): 
agcgggtggcgtcatagtggagcgctgagggcttggtggcgtggggtgggggctgtcctactgatcctgaatttggggtcactgatggctacagaaccaa
agaaagctgcagcccagaactctccagaggatgaaggacttctgatagtgaagatagaagaggaagaatttatccatgggcaggacacttgcttacagag
aagtgaactccttaagcaggagctctgcaggcagctttttaggcagttctgctaccaggattctcctggacctcgcgaggcactgagccgcctccgggag
ctctgctgtcagtggctgaagccagagatccataccaaggaacagattctggaactgctggtgctagagcagttcctgaccatcctgccaggagatttgc
aggcctgggtacatgaacattacccagagagtggagaggaggcagtgaccatactagaagatttggagagaggcactgatgaagcagtactccaggttca
agcccatgaacatggacaagaaatattccagaaaaaagtgtcacctcctggaccagcacttaatgtcaagttacagccagtggagaccaaggcccatttt
gattcatcagaaccccagctcctatgggactgtgataatgagagtgaaaacagtagatccatgccaaagctggaaatttttgaaaaaattgaatcacaga
gaattatatctggaagaatctcaggatacatatcagaagcgtctggtgagtctcaagacatctgtaagtctgcaggcagggtaaagagacaatgggaaaa
agaatcaggggagtctcagagactctcgtctgcccaggatgaaggttttggtaaaatcctcacccacaaaaatacagtcagaggtgaaataataagccac
gatggatgtgagaggagattaaatctgaactcaaatgaattcacacaccagaaatcttgtaaacatggtacctgtgaccagagcttcaaatggaactcag
attttattaaccatcaaataatttatgctggagaaaaaaatcaccaatatggaaaatctttcaagagcccaaaacttgctaaacatgcagcagttttcag
tggagataaaactcatcagtgtaatgaatgtgggaaagctttcaggcacagctcaaaacttgctaggcatcagagaatccacactggagagagatgctat
gaatgtaatgaatgtgggaaaagctttgcagagagctcagatcttactagacatcggcgaattcacactggggaaagaccctttggttgcaaagaatgtg
ggagagcattcaacctgaactcacatcttatcaggcatcagagaattcacaccagagagaaaccctacgagtgtagtgaatgtgggaaaaccttccgagt
gagctcacatcttattcgacactttagaattcacactggagaaaaaccctatgaatgcagtgagtgtggaagagccttcagtcagagctcaaaccttagt
caacaccagagaattcacatgagggaaaacctattaatgtaaggaacttaaatttgtaagtaaatgctgaggaaatggcacaatatgaaaaatattaaat
aaaaaataaatattgggcaagatggaagacagaaaaaaaaaaaaaaaa