Human ORFeome, Internal ID: 1536
BC number:  BC017590 UCSCEntrez Gene ID:  414061
Length: 438Symbol:  DNAJB3
Resource Plate: GDEh81022Resource Plate Position:  C12
Lentiviral Plate: CCSBBroad304_090D1Lentiviral Position:  B12
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGTGGACTACTACGAGG
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCACTGAAGGCAGAGAAAAGG
Description:  DnaJ (Hsp40) homolog, subfamily B, member 3 CHROMOSOME: 2
Template Information: 
Vendor Plate:  26Vendor Position:  H09
Collection:  Vendor Name: Open Biosystems
Vector: pBluescriptRCatalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_97 testis
Clone ID:  4828023 Genbank Accession: KJ900752
GI:  34190157
MGC Coding Sequence: 
atggtggactactacgaggtgctggacgtgccccggcaggcctcatccgaggccatcaagaaggcgtaccgcaagctggcgctcaagtggcaccccgaca
aaaaccctgagaacaaggaggaagcggagaggagattcaagcaggtggccgaggcctacgaggtgttgtcggacgccaagaaacgcgatatctatgaccg
ctatggcgaggcgggcgcggagggcggctgcacaggcggcaggcccttcgaggaccccttcgagtacgtcttcagcttccgcgacccagccgacgtcttc
agggagttcttcggcggccaggacccattctcctttgacctcttgggaaacccgctggagaatattttgggggggtcagaggaactgctggggaagcaga
agcagagcgtctgcaccccttttctctgccttcagtga
cDNA Sequence (including UTRs): 
agggggcccaggtctccgagcactcgggcctgcgcctgggtgctggcagccttgccgctcgctgtgccagtgcctggtgggccgttctggccatccagca
tggtggactactacgaggtgctggacgtgccccggcaggcctcatccgaggccatcaagaaggcgtaccgcaagctggcgctcaagtggcaccccgacaa
aaaccctgagaacaaggaggaagcggagaggagattcaagcaggtggccgaggcctacgaggtgttgtcggacgccaagaaacgcgatatctatgaccgc
tatggcgaggcgggcgcggagggcggctgcacaggcggcaggcccttcgaggaccccttcgagtacgtcttcagcttccgcgacccagccgacgtcttca
gggagttcttcggcggccaggacccattctcctttgacctcttgggaaacccgctggagaatattttgggggggtcagaggaactgctggggaagcagaa
gcagagcgtctgcaccccttttctctgccttcagtgaatttccagcttttgggggtgttttttcttcttttgatacaggatttcgttcctttggctccct
gggaagtgggggcctttcttccttctgcatgtcctacggtagtgatgggacaggcagcttcaagtccatgtcgacttccactgaaatagttgatggtaaa
aaaatcaccaccaagagaatcattgagaatggccaagaaagggtggaagtggaggaagatggagagttgagttaaagtccttcataataaatagcaaaga
gcagttactccgcattgacaccaagtaattccagtccacatttgactttaagcacatctggaggaatagcggactttttttaggattgaaagtgaacttt
actttcagaacagctgtacccaagaatttataaacacttcatgccaacacctgttcttatcgttgggactacacggataggacctctgtttgtctttcaa
tcgttgtaaaatatctgtatgcaatttgctatttattaaacttaagcctgaaaaaaaaaaaaaaaa