Human ORFeome, Internal ID: 1511
BC number:  BC016746 UCSCEntrez Gene ID:  132989
Length: 354Symbol:  C4orf36
Resource Plate: GDEh81008Resource Plate Position:  F11
Lentiviral Plate: CCSBBroad304_148D1Lentiviral Position:  H08
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGCGTATGGAGTGCCAA
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCATTTAGATGGAAGAGGTCTTCTCAA
Description:  chromosome 4 open reading frame 36 CHROMOSOME: 4
Template Information: 
Vendor Plate:  26Vendor Position:  F04
Collection:  Vendor Name: Open Biosystems
Vector: pBluescriptRCatalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_97 testis
Clone ID:  4827131 Genbank Accession: KJ895487
GI:  16876935
MGC Coding Sequence: 
atggcgtatggagtgccaagaaagaacacagtgaaaaccattttgcggggcagttgttataatgtacaggaaccttgggatattgcattgcttgcaaaga
cctggtacacaaacctagccaatatcaagttgcctttcttggaagaaatttcatttggtggttctgtgcagctcacaaaatgtaccaccattaaagatgg
actgctcccttctgcagaatctatcaaactcgaaagggagtatgaagtgaagcgtctttgtaaactgaagtgtcaagaaaatacatctaaggaaattcag
cttctcctgagggaaaggccagccggtttgagaagacctcttccatctaaatga
cDNA Sequence (including UTRs): 
agcggaggcgtgtgcctgcggcgcggccccgaggcgtgtgcgcggccatgtgcgcttagcgcagcgcgctcttacctcagtaccccggccgcgaccctcc
gagcccctggagcccgggtaaccaggccgccggcgccggctcgcggggacccgccaccctggaagccccgcgcacacagcgcattcctggcgagtcggag
gcagggtggggcccaggtaaagtgaacagagttatctgtgacattccatcaggcacctatgtaacgaaatcataccgtaataactcaccatggcgtatgg
agtgccaagaaagaacacagtgaaaaccattttgcggggcagttgttataatgtacaggaaccttgggatattgcattgcttgcaaagacctggtacaca
aacctagccaatatcaagttgcctttcttggaagaaatttcatttggtggttctgtgcagctcacaaaatgtaccaccattaaagatggactgctccctt
ctgcagaatctatcaaactcgaaagggagtatgaagtgaagcgtctttgtaaactgaagtgtcaagaaaatacatctaaggaaattcagcttctcctgag
ggaaaggccagccggtttgagaagacctcttccatctaaatgacacctgaagcgcggattgtagatgaagaaactcagcagcgccggcgggaactgcttc
tcctgggccgcccaggacccgctcccggccccggccgtcgctgcgctgcagccatcctggcccggcccccacctcaggaagcctcccacggcccgcccag
agaccgagaaaatctcttaatttcagtggaaaaaaaaaaaaaaaa