Human ORFeome, Internal ID: 1483
BC number:  BC022011 UCSCEntrez Gene ID:  7180
Length: 732Symbol:  CRISP2
Resource Plate: GDEh81039Resource Plate Position:  E01
Lentiviral Plate: CCSBBroad304_046D1Lentiviral Position:  C03
Forward Primer:  GGGGACAACTTTGTACAAAAAAGTTGGCATGGCTTTACTACCGGTGTT
Reverse Primer:  GGGGACAACTTTGTACAAGAAAGTTGGGCAGTAAATTTTGTTCTCACATAGG
Description:  cysteine-rich secretory protein 2 CHROMOSOME: 6
Template Information: 
Vendor Plate:  26Vendor Position:  C05
Collection:  Vendor Name: Open Biosystems
Vector: pBluescriptRCatalog Number: 
Information Source: MGC DOWNLOAD Library: NIH_MGC_97 testis
Clone ID:  4826427 Genbank Accession: KJ892314
GI:  34190281
MGC Coding Sequence: 
atggctttactaccggtgttgtttctggttactgtgctgcttccatctttacctgcagaaggaaaggatcccgcttttactgctttgttaaccacccagt
tgcaagtgcaaagggagattgtaaataaacacaatgaactaaggaaagcagtctctccacctgccagtaacatgctaaagatggaatggagcagagaggt
aacaacgaatgcccaaaggtgggcaaacaagtgcactttacaacatagtgatccagaggaccgcaaaaccagtacaagatgtggtgagaatctctatatg
tcaagtgaccctacttcctggtcttctgcaatccaaagctggtatgacgagatcctagattttgtctatggtgtaggaccaaagagtcccaatgcagttg
ttggacattatactcagcttgtttggtactcgacttaccaggtaggctgtggaattgcctactgtcccaatcaagatagtctaaaatactactatgtttg
ccaatattgtcctgctggtaataatatgaatagaaagaataccccgtaccaacaaggaacaccttgtgccggttgccctgatgactgtgacaaaggacta
tgcaccaatagttgccagtatcaagatctcctaagtaactgtgattccttgaagaatacagctggctgtgaacatgagttactcaaggaaaagtgcaagg
ctacttgcctatgtgagaacaaaatttactga
cDNA Sequence (including UTRs): 
gcagctcctcaacgccgcaacgcgccggcccaactgcaggaaggtctgtgctctggagccaggggttataaaattatacaccatggccctcctaaagaca
ctctaggaaaaccatgtcatcctgatcttaaaacacctgcaagaaagagcacagtacttcaccattaataaagtagatatttcatcctgctcagaaaacc
aacatttccagcaatggctttactaccggtgttgtttctggttactgtgctgcttccatctttacctgcagaaggaaaggatcccgcttttactgctttg
ttaaccacccagttgcaagtgcaaagggagattgtaaataaacacaatgaactaaggaaagcagtctctccacctgccagtaacatgctaaagatggaat
ggagcagagaggtaacaacgaatgcccaaaggtgggcaaacaagtgcactttacaacatagtgatccagaggaccgcaaaaccagtacaagatgtggtga
gaatctctatatgtcaagtgaccctacttcctggtcttctgcaatccaaagctggtatgacgagatcctagattttgtctatggtgtaggaccaaagagt
cccaatgcagttgttggacattatactcagcttgtttggtactcgacttaccaggtaggctgtggaattgcctactgtcccaatcaagatagtctaaaat
actactatgtttgccaatattgtcctgctggtaataatatgaatagaaagaataccccgtaccaacaaggaacaccttgtgccggttgccctgatgactg
tgacaaaggactatgcaccaatagttgccagtatcaagatctcctaagtaactgtgattccttgaagaatacagctggctgtgaacatgagttactcaag
gaaaagtgcaaggctacttgcctatgtgagaacaaaatttactgatttacctagtgagcattgtgcaagactgcatggataagggctgcatcatttaatt
gcgacataccagtggaaattgtatgtatgttagtgacaaatttgatttcaaagagcaatgcatcttctcccccagatcatcacagaaatcactttcaggc
aatgatttacaaaagtagcatagtagatgatgacaactgtgaactctgacataaatttagtgctttataacgaactgaatcaggttgaggattttgaaaa
ctgtataaccataggatttaggtcactaggactttggatcaaaatggtgcattacgtatttcctgaaacatgctaaagaagaagactgtaacatcattgc
cattcctactacctgagtttttacttgcataaacaataaattcaaagctttacatctgcaaaaaaaaaaaaaaaa